Invest Clin 66(3): 269 - 281, 2025 https://doi.org/10.54817/IC.v66n3a04

Corresponding author: Shuo Zhang. Department of Pneumonology, Second Affiliated Hospital of Tianjin

University of TCM. No. 69, Zengchan Street, Hebei District, Tianjin 300250, China. Tel: +86 13821172351.

Email: zhangshuottt@126.com

Experimental study on the regulatory

effect of Qinggan Dongyin on T lymphocyte

homeostasis in MRL/lpr mice.

Nan Jiang1#, Xiangqing Che1#, Haiyan Han2, Haoyang Xin1, Shuo Wang2,

Jingpeng Li1 and Shuo Zhang3

1Department of Rheumatology and Immunology, Second Affiliated Hospital of Tianjin

University of TCM, Tianjin, China.

2Tianjin University of Traditional Chinese Medicine, Tianjin, China.

3Department of Pneumonology, Second Affiliated Hospital of Tianjin University of TCM,

Tianjin, China.

#These authors contributed equally to this work and share first authorship.

Keywords: lupus erythematosus, systemic, Qinggan Dongyin, T-lymphocytes, signal

pathways, cGAS-STING protein, mouse.

Abstract. Systemic lupus erythematosus (SLE) is an autoimmune disease

marked by autoantibody overproduction and increased infection risk, even with

current treatments. Dysregulated T lymphocyte homeostasis contributes to

SLE progression, prompting exploration of immunomodulatory therapies. This

study evaluated the effects of Qinggan Dongyin (QGDY), a compound of tradi-

tional Chinese medicine, in a murine SLE model. Twelve female MRL/lpr mice

were randomly divided into model and QGDY treatment groups (n=6 each),

with age-matched C57BL/6 mice as controls. QGDY (5 mL/kg/day) was ad-

ministered via gavage for two weeks; controls received saline. Flow cytometry

analyzed T cell subsets (CD4+, CD8+, Treg, Th1, Th2, Th17), ELISA measured

plasma cytokines (IFN-γ, IL-6, TNF-α, IL-17A, TGF-β), HE staining assessed

lung and kidney pathology, and qPCR evaluated cGAS and STING expression.

Compared to the model group, QGDY significantly restored T cell balance by

increasing CD4+, CD8+, and Treg cells and reducing Th1, Th2, and Th17 cells

(p<0.01). QGDY also lowered pro-inflammatory cytokine levels (p<0.05), im-

proved organ histopathology, and normalized elevated cGAS and STING expres-

sion (p<0.01). These findings indicate that QGDY exerts immunomodulatory

effects in SLE, suggesting therapeutic potential through the regulation of T

cell function and inflammatory signalling pathways.

270 Jiang et al.

Investigación Clínica 66(3): 2025

Estudio experimental sobre el efecto regulador de Qinggan

Dongyin en la homeostasis de los linfocitos T en ratones

MRL/lpr.

Invest Clin 2025; 66 (3): 269 – 281

Palabras clave: lupus eritematoso sistémico; Qinggan Dongyin linfocitos T; vías de

señalización; proteínas cGAS y STING de ratón.

Resumen. El lupus eritematoso sistémico (LES) es una enfermedad auto-

inmune caracterizada por la sobreproducción de autoanticuerpos y un aumento

del riesgo de infección, incluso con los tratamientos actuales. La homeosta-

sis desrregulada de los linfocitos T contribuye a la progresión del LES, lo que

impulsa la exploración de terapias inmunomoduladoras. Este estudio evaluó

los efectos de Qinggan Dongyin (QGDY), un medicamento tradicional chino

compuesto, en un modelo murino de LES. Doce ratones hembras MRL/lpr fue-

ron divididas aleatoriamente un grupo modelo y un grupo de tratamiento con

QGDY (n=6 en cada grupo), con ratones C57BL/6 emparejados por edad como

controles. Se administró QGDY (5 mL/kg/día) por medio de sonda durante dos

semanas; los controles recibieron solución salina. Se analizó la subpoblación de

células T (CD4+, CD8+, Treg, Th1, Th2, Th17) mediante citometría de flujo,

se midieron las citoquinas plasmáticas (IFN-γ, IL-6, TNF-α, IL-17A, TGF-β) por

ELISA, se evaluó la patología pulmonar y renal mediante tinción con HE, y se

evaluó la expresión de cGAS y STING mediante qPCR. En comparación con el

grupo modelo, QGDY restauró significativamente el equilibrio de las células T

al aumentar las células CD4+, CD8+ y Treg y reducir las células Th1, Th2 y

Th17 (p<0,01). QGDY también disminuyó los niveles de citoquinas proinflama-

torias (p<0,05), mejoró la histopatología de órganos y normalizó la expresión

elevada de cGAS y STING (p<0,01). Estos hallazgos indican que QGDY ejerce

efectos inmunomoduladores en el LES, sugiriendo un potencial terapéutico a

través de la regulación de la función de las células T y las vías de señalización

inflamatoria.

Received: 25-03-2025 Accepted: 24-06-2025

INTRODUCTION

Systemic lupus erythematosus (SLE)

is a chronic autoimmune disorder marked

by the overproduction of autoantibodies

and the formation of immune complexes,

which can impact various organs and sys-

tems 1. While advancements in diagnosis and

treatment have enhanced the survival rate

of SLE patients, the mortality rate remains

high 2. Infections, particularly in the context

of the recent global spread of SARS-CoV-2,

have emerged as a significant cause of death

among SLE patients 3. Research indicates

that SLE patients face significantly higher

risks compared to the general population 4-5.

In autoimmune diseases such as SLE,

infection and autoimmune response inter-

act with each other. On the one hand, infec-

tion can destroy the immune tolerance to

autoantigens and induce the development

of autoimmune diseases in individuals with a

genetic predisposition. The persistent infec-

tion of pathogens may lead to the aggrava-

Effect of Qinggan Dongyin on T lymphocytes 271

Vol. 66(3): 269 - 281, 2025

tion of disease activity via molecular simula-

tion, bystander activation, epitope diffusion

or polyclonal activation 6. On the other

hand, high disease activity, immune dysregu-

lation, and drugs (such as glucocorticoids

and immunosuppressants) induce immune

deficiency and organ failure 2.

Lymphocytes are key players in the

pathogenesis of SLE 7,8. Dysregulation of

T lymphocytes, including changes in cell

count, subset distribution, and function, is

implicated in the progression of SLE and is

closely linked to infection risk 9. Specifically,

a reduction in CD4+ T cells is the most fre-

quently reported hematological abnormality

in SLE, often correlating with a higher risk

of infection 10. Meanwhile, CD8+ T cells,

which are cytotoxic and typically destroy tar-

get cells through the release of perforin and

granzyme, show impaired function in SLE

patients. This dysfunction leads to increased

risks of both infections and autoimmune re-

actions 11. In addition, Treg, Th1, Th2, and

Th17 cells are important subsets of CD4+

T lymphocytes, and their distribution and

function are significantly disordered. The ab-

solute decrease in the number of Tregs is as-

sociated with immune tolerance disruption

and the subsequent worsened disease activ-

ity and increased infection risk in SLE pa-

tients 12. Meanwhile, the increase in Th cell

activity may enhance the local tissue inflam-

mation and damage important target organs

such as the kidneys 13-15. Therefore, regula-

tion of the T lymphocyte homeostasis in SLE

patients may effectively control the autoim-

mune response while maintaining immune

function and preventing infection, hopefully

providing an effective treatment method to

meet the urgent clinical need.

Qinggan Dongyin (QGDY) is a com-

pound preparation consisting of multiple

Chinese herbal medicines, it was developed

based on the experience of Academician

Zhang Boli’s team in the prevention and

control of a novel coronavirus infection in

Wuhan 16, and the main therapeutic goal of

this prescription is to protect vital qi (de-

fined as enhancing the body’s defenses and

promoting recovery in traditional Chinese

medicine), resist exopathogens, and clear

away heat and toxic material. Clinical stud-

ies have shown that QGDY is highly effective

in preventing respiratory tract infections

with a favorable safety profile 16. Network

pharmacological studies have shown that

QGDY plays a regulatory role in various viral

infections by regulating the immune-inflam-

matory response caused by infection17. Phar-

macological studies have also found that

QGDY has antioxidant and anti-inflammato-

ry activities, and significantly regulates the

number of lymphocytes, the level of interleu-

kin and the release of TNF-α in in peripheral

blood 18-19. The usefulness of QGDY in infec-

tions has been reported, but the experience

with this substance in autoimmune diseases

has not. In the present study, the SLE mouse

model (MRL/lpr mouse) was intervened with

QGDY. The distribution of T lymphocyte sub-

sets, expression of related cytokines, and

pathological damage of lung and kidney in

these mice were observed to clarify the regu-

latory effects of QGDY on T lymphocyte ho-

meostasis and immune response in MRL/lpr

mice, providing supportive data for adjuvant

treatment of SLE and risk reduction of infec-

tion.

MATERIALS AND METHODS

Instruments and reagents

Main instruments included BD FACS-

Calibur flow cytometer (BD, USA), ELX800

microplate reader (BioTek, USA), inverted

microscope (Nikon TS2), desktop high-speed

refrigerated microcentrifuge (D3024R,

DLAB Scientific Co., Ltd), and fluorescence

quantitative PCR instrument (Stepone plus,

ABI, USA).

Main reagents included FITC anti-

mouse CD3 antibody (item number: E-AB-

F1013C), PE anti-mouse CD4 antibody (item

number: E-AB-F1097D), PerCP anti-mouse

CD8a antibody item number: E-AB-F1104F),

APC anti-mouse Foxp3 antibody (item

272 Jiang et al.

Investigación Clínica 66(3): 2025

number: E-AB-F1238E), APC anti-mouse

CD183/CXCR3 antibody (item number: E-

AB-F1114E), APC anti-human/mouse CD44

antibody (item number: E-AB-F1100E), APC

anti-mouse IL-17A antibody (item number:

E-AB-F1272E), all antibodies were purchased

from Elabscience. Other reagents were he-

matoxylin (Servicebio, item number: G1004-

100ML), eosin staining solution (Solarbio,

item number: G1108), mouse interferon

gamma (IFN-γ) ELISA kit (Meimian, item

number: MM-0182M2), mouse IL-6 ELISA

kit (Meimian, item number: MM-0163M2),

mouse TNF-α ELISA kit (Meimian, item

number: MM-0180R2), mouse IL-17A ELISA

kit (Meimian, item number: MM-0180R2),

mouse TGF-β ELISA kit (Meimian, item

number: MM-0689M2), mouse PFP ELISA

kit (Meimian, item number: MM-4504M2),

Trizol reagent (Vazyme, item number: R401-

1), and MonAmp™ SYBR® Green qPCR Mix

(Wuhan Monad Biotechnology Co., Ltd.,

item number: MQ10201S).

Experimental animals and grouping

Twelve female MRL/lpr mice, aged

eight weeks, were randomly assigned to

two groups: the model group and the QGDY

group, with six mice in each. Additionally,

six age-matched female C57BL/6 mice were

used as the control group. All mice were

purchased from SPF (Beijing) Biotechnol-

ogy Co. Ltd. The mice were housed in a

room with natural lighting, maintained at a

temperature of 20-24°C, with proper venti-

lation and humidity control. After a 1-week

acclimatization period with free access to

food and water, the experiment commenced

once the mice were in optimal health. The

study was approved by the Animal Ethics

Committee (Approval No. IRM/IRM/2-IA-

CUC-2403-126).

Preparation and concentration of QGDY

QGDY consisted of Astragalus mem-

branaceus 18g, Polygonum cuspidatum 18g,

stir-baked Fructus arctii 18g, Belamcanda

sinensis 12g, Platycodon grandiflorum 12g,

Radix paeoniae rubra 12g, Perilla frutescens

leaves 12g, honeysuckle 18g, charred haw-

thorn 12g, and licorice 6g. The dosage was

calculated based on the “Table of equivalent

dose ratios between humans and animals by

body surface area” 1. 0.3588g, i.e., 17.94g/

kg, of QGDY crude drug, was required for a

20g mouse per day, assuming that the co-

efficient between humans (70kg) and mice

(20g) was 0.0026 and that 138g of the crude

drug was needed for each patient daily. All

medicinal herbs were boiled twice, and the

decoction was combined, filtered, and con-

centrated to obtain a medicinal solution

containing 3.6g/mL of crude drug. Animals

in the QGDY group were given QGDY by

gavage at a dose of 5mL/kg, while those in

the control group and the model group were

given normal saline by gavage at a dose of

5ml/kg for two consecutive weeks, once a

day. Gavage was administered at a fixed time

(9:00-10:00 am) every day without fasting.

Sample collection and processing

After two weeks of intragastric admin-

istration, mice in each group were anes-

thetized with 1% pentobarbital sodium to

reduce their stress response. Plasma was col-

lected, and the mice were then sacrificed to

collect corresponding samples. (1) Plasma

was collected. Briefly, the blood was collect-

ed from the eyeballs of mice, and placed in

a centrifuge tube containing EDTA for anti-

coagulation at RT for two hours, followed by

centrifugation at 3500rpm for 15 minutes.

The supernatant was collected and frozen

at −80℃ in an EP tube for ELISA. (2) Fol-

lowing euthanasia, the abdominal cavity was

opened to remove the lungs. The left lung

was fixed in 4% paraformaldehyde for histo-

pathological analysis, while the right lung

was collected for PCR testing. (3) After sac-

rificing the mice with various treatments,

the abdominal cavity was opened to extract

the left kidney, which was fixed in 4% para-

formaldehyde for pathological examination.

In contrast, the right kidney was stored at

−80℃ for potential future analysis or as a

Effect of Qinggan Dongyin on T lymphocytes 273

Vol. 66(3): 269 - 281, 2025

backup sample. Additionally, the spleen was

removed and placed in PBS for subsequent

flow cytometry analysis.

Testing indexes and methods

Flow cytometry

Splenic tissue was sliced, ground and

filtered, and the tissue filtrate was used to

isolate monocytes. Briefly, an appropriate

amount of separation solution of Lympho-

prep (AN1001967) from Shanghai Shanjin

Biotechnology Co., Ltd (Shanghai, China)

was added to the centrifuge tube, and the

diluted tissue filtrate was placed on top of

the separation solution, with attention to

keep the interface clear between the two liq-

uid layers. The tube was centrifuged using a

horizontal rotor at 500 x g for 20 minutes

at RT. After centrifugation, layers were seen:

the top layer contained the diluted plasma,

the middle layer was the transparent separa-

tion solution, with a white membrane layer

between the plasma and the separation solu-

tion, which was the lymphocyte layer, and the

red blood cells and granulocytes gathered

at the bottom of the centrifugation tube.

Cells in the white membrane were carefully

removed and placed in a clean 15mL centri-

fuge tube, and washed with 10 mL PBS, fol-

lowed by centrifugation at 250×g for 10 min-

utes. The supernatant was discarded, 5mL

PBS was added to resuspend the cells, and

the cells were centrifuged at 250 × g for 10

minutes. This step was repeated twice. After

centrifugation, the supernatant was discard-

ed, and the cells were resuspended. 1 × 105

cells and 100μL (1 ×) Binding Buffer were

added to each sample tube, and staining

was performed. Cells were first washed twice

with PBS. Subsequently, Cyto-Fast Fix/Perm

Buffer was added to fix the cells, which were

then incubated at 4℃ for 20 minutes before

being rewashed with PBS. APC-conjugated

anti-mouse Foxp3 antibody (ab215206) for

Treg cells, CD4 antibody (ab237722) for

CD4+ T cells, CD8 antibody (ab237709)

for CD8+ T, IFN-γ antibody (ab280353) for

Th1 cells, IL-4 antibody (ab225638) for Th2

cells, and IL-17A antibody (ab302922) for

Th17 cells from Abcam biotechnology com-

pany (UK) was added and incubated for 15

minutes. An additional 400 μL of 1x Binding

Buffer was added to each tube, followed by

filtration of the mixture. A total of 10,000

cells were collected from the stained sam-

ples using a BD FACSCalibur flow cytometer.

ELISA

Plasma levels of IFN-γ (H025-1-2), IL-

17A (H014-2), TGF-β (H034-1-1) were pur-

chased from the Nanjing Jiancheng Bio-

engineering Institute (Nanjing, China),

and the IL-6 (ab222503, Abcam), TNF-α

(ab183218, Abcam), and perforin protein

(PFP) (ab114201, Abcam) were obtained

from Abcam biotechnology company for in-

flammatory factor detection using ELISA

kits following the manufacturer’s protocols.

The OD of each well was detected with an

ELX800 microplate reader at a wavelength

of 450 nm.

HE staining

Lung and kidney tissues fixed in 4% para-

formaldehyde underwent dehydration, clari-

fication, paraffin embedding, and section-

ing. Following HE staining, the pathological

changes in the lungs and kidneys were exam-

ined for each group (control group, model

group, and QGDY group), under a light mi-

croscope at magnifications of 200x (top row)

and 400x (bottom row). For the histological

parameters, the inflammatory cell infiltra-

tion (neutrophils and lymphocytes), alveolar

structure changes (Alveolar wall thickness,

alveolar cavity, and interstitial fibrosis) were

examined in lung tissues, while the vacuoles,

glomerular consolidation, glomerular struc-

ture change, inflammatory cell infiltration,

and cell proliferation were examined in kid-

ney tissues.

Quantitative PCR (qPCR)

Total RNAs were extracted. Briefly, tis-

sues, adherent cells, and whole blood sam-

274 Jiang et al.

Investigación Clínica 66(3): 2025

ples were pretreated and lysed using an RNA

extraction solution, followed by centrifuga-

tion and precipitation of RNA. The concen-

tration and purity of RNAs were determined.

Next, reverse transcription was performed.

A reverse transcription reaction system

containing a gDNA digestion mixture and

Hifair® III SuperMix was prepared, and the

reaction program was set (25℃, 55℃, and

85℃). The quantitative PCR was conducted.

A PCR reaction system was prepared using

MonAmp™ SYBR® Green qPCR Mix and

primers, and temperature cycles, including

pre-denaturation, denaturation, annealing,

elongation, and melting curves, were set. Fi-

nally, the fold expressions of the target genes

were calculated using the 2^-ΔΔCt method

to evaluate their relative expression levels.

The sequences of primers used included:

Primers for inflammation-related genes of

cyclic GMP-AMP synthase (cGAS): forward

(cGAS-F): TATGGCGGTGACACACTTCC,

and reverse (cGAS-R): GTCAGGACAGGT-

GAGCAGAC; primers for mouse stimulator of

interferon gene (STING): forward (STING-F):

TGTCTGGCTGAAGAGCTGTG, and reverse

(STING-R): CGATTCTTGATGCCAGCACG.

Statistical analysis

Statistical analysis was performed using

the IBM SPSS Statistics 26 software. Quanti-

tative data were expressed as mean±standard

deviation, while measurement data were re-

ported as median (interquartile range) [M

(IQR)]. For comparisons between groups,

normally distributed data were analyzed us-

ing one-way ANOVA followed by Tukey’s test,

whereas non-normally distributed data were

evaluated using the non-parametric Kruskal-

Wallis test, p<0.05 was considered statisti-

cally significant.

RESULTS

Distribution of immune cells and Treg

lymphocytes in the spleens of mice

in each group

Significant differences were observed

in the expression levels of various lympho-

cyte subsets between the groups. The model

group exhibited a notable decrease in CD4+

T, CD8+ T, and Treg cells, while Th1, Th2, and

Th17 lymphocytes were elevated (p<0.01).

In contrast, the QGDY group showed a re-

versal of these trends, with increased levels

of CD4+ T, CD8+ T, and Treg cells and de-

creased levels of Th1, Th2, and Th17 lympho-

cytes (p<0.01) (Table 1).

Concentrations of plasma IFN-γ, IL-6,

TNF-α, IL-17A, TGF-β and PFP in each

group of mice

Significant changes in plasma cytokine

levels were observed between the groups. The

Table 1. Distribution of CD4 + T, CD8 + T, Th1, Th2, Th17 and Treg cells in the spleen

of mice in each group.

Control group

(n=6)

Model group

(n=6)

QGDY group

(n=6)

CD4+ T (%)

CD8+ T (%)

Th1 (%)

Th2 (%)

Th17 (%)

Treg (%)

19.60 ± 1.05

12.65 ± 1.10

0.85 ± 0.26

0.76 ± 0.12

1.34 ± 0.34

2.59 ± 0.14

15.40 ± 0.30***

6.33 ± 0.46***

3.40 ± 0.51**

3.26 ± 0.71***

2.86 ± 0.16***

0.59 ± 0.26**

17.60 ± 0.57###

9.52 ± 0.19###

1.60 ± 0.11##

1.58 ± 0.05###

1.95 ± 0.15###

1.61 ± 0.08##

Note: Cells of CD4-positive T cells (CD4+ T), CD8-positive T cells (CD8+ T), T-helper 1 cells (Th1), T-helper 2 cells

(Th2), T-helper 17 cells (Th17), Regulatory T cells (Treg) in model and treatment group compared with the control

group using one-way ANOVA method, and the mean ± standard deviation (SD) is used for the result representation.

**p<0.01, ***p<0.001; compared with the model group, ###p<0.001, ##p<0.01.

Effect of Qinggan Dongyin on T lymphocytes 275

Vol. 66(3): 269 - 281, 2025

model group exhibited higher levels of IFN-γ,

IL-6, TNF-α, IL-17A, and TGF-β (p<0.05),

while the level of PFP was lower (p<0.05). In

the QGDY group, the levels of IFN-γ, TNF-α,

IL-17A, and TGF-β were reduced compared

to the model group (p<0.05) (Table 2).

Pathological analysis of lung and kidney

tissues in each group of mice

In the control group, the pulmonary al-

veoli were evenly distributed with neatly ar-

ranged cells, the alveolar wall was thin and

uniform, and the alveolar cavity was clear

and visible. In contrast, the model group ex-

hibited disordered cell arrangement, thick-

ened alveolar walls and narrowing or even

occlusion of the alveolar cavities, increased

lung parenchyma, and more severe inflam-

mation. The QGDY group showed improved

cell arrangement, reduced lung parenchy-

ma, and less inflammation compared to the

model group (Fig. 1).

Table 2. Concentrations of IFN-γ, IL-6, TNF-α, IL-17A, TGF-β and PFP in the plasma

of mice in each group.

Control group

(n=6)

Model group

(n=6)

QGDY group

(n=6)

IFN-γ (ng/L)

IL-6 (pg/mL)

TNF-α (ng/L)

IL-17A (pg/mL)

TGF-β (ng/L)

PFP (ng/L)

120.56 ± 42.44

31.05 ± 11.39

80.94 ± 46.70

20.26 ± 6.09

24.53 ± 24.68

49.83 ± 24.07

461.76 ± 304.88*

86.16 ± 71.44*

385.03 ± 238.84**

105.87 ± 46.26**

190.48 ± 148.21**

11.34 ± 7.53**

168.99 ± 36.32#

28.28 ± 45.16

189.11 ± 204.82#

45.99 ± 42.64#

62.24 ± 40.51#

31.21 ± 17.88

Note: The cytokines of Interferon-gamma (IFN-γ), Interleukin-6 (IL-6), Tumor Necrosis Factor-α (TNF-α), Interleu-

kin-17A (IL-17A), Transforming Growth Factor-beta (TGF-β), Perforin (PFP) in model and treatment groups compa-

red with the control group using One-way ANOVA method, and the mean ± standard deviation (SD) is used for the

result representation. *p<0.05, **p<0.01; compared with the model group, #p<0.05.

Fig. 1. Histopathological changes in lung tissues of different groups (HE staining).

Inflammation was defined as the presence of increased numbers of inflammatory cells (primarily neu-

trophils and mononuclear cells) within the alveolar spaces and interstitial areas.

Alveolar cavity

Alveolar wall

Alveolar cavity

Alveolar wall

Alveolar cavity

Alveolar wall

276 Jiang et al.

Investigación Clínica 66(3): 2025

Overall, the degree of inflammation was

assessed by evaluating the density and dis-

tribution of these cells. The control group

showed minimal to no inflammation, while

the model group exhibited significant infiltra-

tion of inflammatory cells. The QGDY group

showed a reduction in inflammatory cell infil-

tration compared to the model group.

Regarding kidney pathology, the con-

trol group had intact glomerular morphol-

ogy with minimal inflammatory cell infiltra-

tion. The model group displayed glomerular

consolidation, vacuoles, proliferation, and

significant inflammatory cell infiltration.

The QGDY group had more orderly glomer-

ular structures and reduced inflammation

compared to the model group (Fig. 2).

Expression of cGAS and STING

Expression levels of cGAS and STING

varied significantly among the control, mod-

el, and QGDY groups (p<0.01). In the model

group, elevated cGAS and STING expressions

were noted compared to the control group,

reflecting heightened immune activation.

Conversely, the QGDY group exhibited re-

duced cGAS and STING levels, nearing those

of the control group, implying that QGDY

might modulate this critical immune signal-

ling pathway (Fig. 3).

Fig. 2. Pathological analysis of kidney tissue in each group of mice.

Fig. 3. qPCR for the expression of cyclic GMP-AMP synthase (cGAS) and stimulator of interferon gene

(STING). (A) The relative expression level of cGAS, and (B) the relative expression level of STING.

A B **(p<0.01)

**(p<0.01)

Glomerulus

Kidney tubules

Glomerulus

Kidney tubules

Glomerulus

Kidney tubules

Effect of Qinggan Dongyin on T lymphocytes 277

Vol. 66(3): 269 - 281, 2025

DISCUSSION

The regulatory effect of QGDY on T

lymphocyte homeostasis and related im-

mune signalling pathways in MRL/lpr mouse

models was investigated in the present

study. These model animals have character-

istics similar to human SLE due to sponta-

neous mutations in the lpr gene (lympho-

proliferation gene), including lymphocyte

abnormalities, lymph node enlargement,

excessive autoantibodies and glomerulone-

phritis 20, making it a classic model for stud-

ies on the immunopathological mechanism

of SLE. The abnormal distribution and dys-

function of T lymphocyte subsets are one

of the key factors in the pathogenesis of

SLE21. Previous studies have revealed signifi-

cant changes in the number of T subsets in

MRL/lpr mice 22. It was found in the pres-

ent study that QGDY significantly improved

the distribution of T lymphocytes in MRL/

lpr mouse models, enhanced the expression

of CD4+, CD8+ and Treg cells, and reduced

the number of Th1, Th2 and Th17 cells. This

prescription also effectively inhibited the

levels of plasma inflammatory factors IFN-γ,

IL-6, TNF-α, IL-17A and TGF-β, indicating its

anti-inflammatory effect. The pathological

evaluation showed that QGDY reduced the

inflammation and damage to the lung and

kidney and maintained the integrity of tissue

structure. In addition, QGDY alleviated im-

mune activation by regulating the cGAS and

STING signalling pathways.

The findings offer fresh evidence sup-

porting the potential use of QGDY in treat-

ing SLE. This study investigated the impact

of QGDY on T cell function in MRL/lpr mice

to elucidate its possible protective role in

SLE. Dysfunctional T cells can elevate infec-

tion risk, particularly during immunosup-

pressive treatment. In SLE patients, compro-

mised CD4+ T cell function not only affects

autoantibody production but also weakens

infection defense. Moreover, impaired CD8+

T cell function further exacerbates the in-

fection risk 23. Regulating T cell function

is crucial for enhancing the autoimmune

response and preventing infections in SLE.

Our study demonstrated that QGDY signifi-

cantly boosted the expression of CD4+ and

CD8+ T cells, thereby strengthening the im-

mune response to infections and lowering

infection risk.

Additionally, QGDY reduced the num-

ber of Th1, Th2, and Th17 cells while in-

creasing Treg cell expression. These changes

are significant because Th1 and Th17 cells

are often overactivated in SLE patients, driv-

ing inflammation through IFN-γ and IL-17

secretion and leading to tissue damage 24.

Thus, QGD’s anti-inflammatory effects may

mitigate SLE pathology by modulating the

activity of these cells. Moreover, the cGAS-

STING signalling pathway’s role is notewor-

thy. QGDY significantly downregulated cGAS

and STING expression, suggesting it curbs

inflammation by inhibiting this pathway’s

overactivation. This mechanism likely im-

pacts T lymphocyte differentiation and func-

tion, improving SLE’s pathological state.

Since the cGAS-STING pathway is linked to

IFN-I production 25, the observed a reduction

in related cytokines after QGDY interven-

tion further supports its immune-regulating

potential.

The high expression levels of TNF-α and

IFN-γ are associated with the activation of

Th1 lymphocytes and tissue damage 26. The

levels of plasma IFN-γ and TNF-α significant-

ly decreased after treatment with QGDY,

indicating the ability of this prescription to

inhibit the activation of Th1 cells and alle-

viate the inflammation in involved organs.

The increase of IL-6 and IL-17 is associated

with Th17-mediated inflammatory response

27. The changes in TGF-β expression may af-

fect the function and quantity of Tregs and

consequently, the immune tolerance. It was

found in the present study that QGDY also

significantly reduced the levels of these two

cytokines, suggesting that it may reduce the

inflammatory response via regulating the

activity of Th17 cells. The changes in TGF-β

level may affect the function and quantity of

278 Jiang et al.

Investigación Clínica 66(3): 2025

Tregs 28, and the results of the present study

showed that QGDY effectively enhanced the

expression of Tregs, providing a basis for the

improvement of immune tolerance. Patho-

logical evaluation of the lungs and kidneys of

mice demonstrated that QGDY significantly

reduced tissue damage in MRL/lpr mice. The

disordered cell arrangement and significant

inflammation observed in the models were

recovered to an improved cell structure and

reduced inflammation after treatment with

QGDY, indicating that QGDY can improve

the pathological changes related to SLE by

regulating T cell function and reducing in-

flammatory factors, providing new ideas for

SLE treatment.

Modern studies have found that the

components of QGDY are rich in various

bioactive substances, including flavonoids,

organic acids, and monoterpenes, which

exert multiple regulatory effects on the hu-

man immune system. The medicinal herbs

in QGDY, such as Astragalus membranaceus

and honeysuckle, can enhance immunity and

prevent inflammation 29, which are in line

with the treatment goals of SLE. Progress

has been made on the effects of individual

medicinal herbs in QGDY on the function

of T lymphocytes. For example, Astragalus

membranaceus has been found to enhance

the proliferation and differentiation of T

lymphocytes and improve the immunity of

body 29. The active compounds contained in

medicinal herbs such as Polygonum cuspi-

datum and stir-baked Fructus arctii regulate

the cytokines produced by T lymphocytes

and affect the function of these cells. Me-

dicinal herbs such as Belamcanda sinensis

and Platycodon grandiflorum have shown the

potential to regulate the balance of T sub-

sets, which can help improve the overactive

state of the immune system. Radix paeoniae

rubra, Perilla frutescens leaves, honeysuckle,

charred hawthorn and Licorice are also in-

volved in the regulation of T cell-mediated

immune responses.

There are limitations in the present

study. First, although the MRL/lpr mouse is a

classical animal model, it cannot completely

simulate the complex pathological process

of human SLE, which may affect the clinical

translation of the results. Second, the sam-

ple size was relatively small. In addition, the

specific effects of individual components of

QGDY on T cell subsets and the underlying

mechanism(s) were not adequately explored,

and an in-depth molecular investigation was

not conducted. Also, the study focused main-

ly on short-term treatment effects and long-

term safety and efficacy were not evaluated.

Finally, clinically relevant indicators such as

improvement in clinical symptoms, quality

of life of patients, and biomarkers were not

evaluated. These limitations reminded us

that caution should be exercised in interpret-

ing the findings and providing directions for

improvement in subsequent studies. Future

studies with samples from broad and diverse

sources are needed for long-term efficacy

evaluation and in-depth discussion of mecha-

nisms further to verify the potential applica-

tion of QGDY in clinical practice.

QGDY significantly improves T lym-

phocyte homeostasis, reduces the levels of

inflammatory factors, and alleviates organ

pathological damage in MRL/lpr mice. Mean-

while, this prescription effectively regulates

the expression of immune-related signalling

molecules such as cGAS and STING, making

it a promising adjuvant therapy for SLE to re-

duce the risk of infection via regulating im-

mune balance, and providing new ideas and

data support for clinical treatment of SLE.

Ethics approval and consent to participate

This study was conducted following the

principles of ethical animal research out-

lined in the Basel Declaration and the ethi-

cal guidelines by the International Council

for Laboratory Animal Science (ICLAS).

This study was conducted under the NC3Rs

ARRIVE guidelines.

The experimental protocol was ap-

proved by the Institute of Radiation Medi-

cine, Chinese Academy of Medical Sciences

Effect of Qinggan Dongyin on T lymphocytes 279

Vol. 66(3): 269 - 281, 2025

and the Peking Union Medical College (Ap-

proval Number: IRM/2-IACUC-2403-126).

Experimental animals underwent all pro-

cedures under anesthesia, and every effort

was made to minimize their pain, suffering,

and death.

Data availability statement

All data generated or analyzed during

this study are included in this article.

Acknowledgements

Not applicable.

Funding

This work was supported by The Sci-

ence & Technology Development Fund of

Tianjin Education Commission for Higher

Education (2023KJ166).

Conflict of interest

The authors declare that they have no

conflict of interest.

ORCID numbers author

• Nan Jiang: 0009-0009-4753-4425;

• Xiangqing Che: 0009-0001-0207-1203

• Haiyan Han: 0009-0009-0386-9565

• Haoyang Xin: 0009-0009-9785-6764

• Shuo Wang: 0009-0000-5597-7757

• Jingpeng Li: 0009-0003-3136-6451

• Shuo Zhang: 0009-0005-6896-0029

Participation of each author

NJ and XC conceived of the study, HH,

HX and SW participated in its design and

coordination, JL and SZ helped to draft the

manuscript. All authors read and approved

the final manuscript.

REFERENCES

1. Kiriakidou M, Ching CL. Systemic Lu-

pus Erythematosus. Ann Intern Med.

2020;172(11): ITC81-ITC96. https://doi.

org/10.7326/AITC202006020.

2. Singh BK, Singh S. Systemic lupus

erythematosus and infections. Reuma-

tismo. 2020;72(3):154-169. https://doi.

org/10.4081/reumatismo.2020.1303.

3. Rao M, Mikdashi J. A Framework to Over-

come Challenges in the Management of

Infections in Patients with Systemic Lupus

Erythematosus. Open Access Rheumatol.

2023; 15:125-137. https://doi.org/doi: 10.

2147/OARRR.S295036.

4. Akhlaq A, Aamer S, Hasan KM, Mu-

zammil TS, Sohail AH, Quazi MA, et al.

Systemic lupus erythematosus is associa-

ted with increased risk of mortality and

acute kidney injury in patients with CO-

VID-19 hospitalization: Insights from a

National Inpatient Sample analysis. Lupus.

2024;33(3):248-254. https://doi.org/10.

1177/09612033241227027.

5. Solé C, Domingo S, Vidal X, Cortés-Her-

nández J. Humoral and cellular response

in convalescent COVID-19 lupus patients.

Sci Rep. 2022;12(1):13787. https://doi.

org/10.1038/s41598-022-17334-5.

6. Rao AP, Patro D. The Intricate Dance of In-

fections and Autoimmunity: An Interesting

Paradox. Indian J Pediatr. 2024;91(9):941-

948. https://doi.org/10.1007/s12098-023-

04928-8.

7. Kang N, Liu X, You X, Sun W, Haneef K,

Sun X, Liu W. Aberrant B-Cell Activation

in Systemic Lupus Erythematosus. Kidney

Dis (Basel). 2022;8(6):437-445. https://

doi.org/10.1159/000527213.

8. Li H, Boulougoura A, Endo Y, Tsokos GC.

Abnormalities of T cells in systemic lupus

erythematosus: new insights in patho-

genesis and therapeutic strategies. J Au-

toimmun. 2022; 132:102870. https://doi.

org/10.1016/j.jaut.2022.102870.

9. Ding M, Jin L, Zhao J, Yang L, Cui S,

Wang X, et al. Add-on sirolimus for the

treatment of mild or moderate systemic

lupus erythematosus via T lymphocyte sub-

280 Jiang et al.

Investigación Clínica 66(3): 2025

sets balance. Lupus Sci Med. 2024;11(1):

e001072. https://doi.org/10.1136/lupus-

2023-001072.

10. Zhang J, Zhang S, Qiao J, Qiu M, Li X.

Risk factors analysis and risk assessment

model construction of systemic lupus

erythematosus patients with infection.

Lupus. 2023;32(1):119-128. https://doi.

org/10.1177/09612033221141255.

11. Chen PM, Tsokos GC. The role of CD8+

T-cell systemic lupus erythematosus

pathogenesis: an update. Curr Opin Rheu-

matol 2021;33(6):586-591. https://doi.

org/10.1097/BOR.0000000000000815.

12. Tsai YG, Liao PF, Hsiao KH, Wu HM,

Lin CY, Yang KD. Pathogenesis and novel

therapeutics of regulatory T cell subsets

and interleukin-2 therapy in systemic lu-

pus erythematosus. Front Immunol 2023;

14:1230264. https://doi.org/10.3389/fim

mu.2023.1230264.

13. Talaat RM, Mohamed SF, Bassyouni IH,

Raouf AA. Th1/Th2/Th17/Treg cytokine

imbalance in systemic lupus erythemato-

sus (SLE) patients: Correlation with di-

sease activity. Cytokine. 2015;72(2):146-

53. https://doi.org/10.1016/j.cyto.2014.

12.027.

14. Dolff S, Bijl M, Huitema MG, Limburg PC,

Kallenberg CG, Abdulahad WH. Distur-

bed Th1, Th2, Th17 and T(reg) balance in

patients with systemic lupus erythemato-

sus. Clin Immunol. 2011;141(2):197-204.

https://doi.org/10.1016/j.clim.2011. 08.005.

15. Paquissi FC, Abensur H. The Th17/IL-17

Axis and Kidney Diseases, With Focus on

Lupus Nephritis. Front Med (Lausanne).

2021; 8:654912. https://doi.org/10.3389/

fmed.2021.654912.

16. Zan SJ, Wang K, Zhang S, Fu K, Zhou SY,

Feng JH, et al. A multicenter cohort study

on “Qinggandong Decoction” for preven-

tion of influenza. China J Tradit Chin Med

Pharm 2023;38(5):1960-1966.

17. Sun Y, Geng Q, Zhao Y, Li C, Chen SF. Me-

chanism of action of Qinggandong decoc-

tion in the treatment of influenza based

on network pharmacology and molecular

docking. Hunan J Tradit Chin Med 2022;

38(01):144-152.

18. Su R, Lu J, Xi ZN, Wang JB, Song XB,

Zhang H, Miao L. Qinggan Dongyin inhibits

LPS-induced inflammation of RAW264.7

macrophages by regulating the NF-κB/

iNOS/NO signaling pathway. J Tianjin Univ

Tradit Chin Med. 2022;41(06):737-745.

19. Ren M, Fu K, Zhou SY, Sun X. Expert con-

sensus on clinical application of “Qinggan

Yin” series pharmaceutics. Tianjin J Tradi

Chin Med. 2020;37(11):1201-1204.

20. Yuan S, Zeng Y, Li J, Wang C, Li W, He Z, et

al. Phenotypical changes and clinical signi-

ficance of CD4+/CD8+ T cells in SLE. Lu-

pus Sci Med. 2022; 9(1): e000660. https://

doi.org/10.1136/lupus-2022-000660.

21. Schile A, Petrillo M, Vovk A, French R,

Leighton K, Dragos Z, et al. A comprehen-

sive phenotyping program for the MRL-lpr

mouse lupus model. J Immunol. 2018;

200:(1_Supplement):40.2. https://doi.org

/10.4049/jimmunol.200.Supp.40.2.

22. Zhang D, Wang M, Shi G, Pan P, Ji J,

Li P. Regulating T Cell Population Alle-

viates SLE by Inhibiting mTORC1/C2 in

MRL/lpr Mice. Front Pharmacol. 2021;11:

579298. https://doi.org/10.3389/fphar.

2020.579298.

23. Contini P, Negrini S, Murdaca G, Borro

M, Puppo F. Evaluation of membrane-

bound and soluble forms of human leu-

cocyte antigen-G in systemic sclerosis.

Clin Exp Immunol. 2018;193(2):152-159.

https://doi.org/10.1111/cei.13134.

24. Hiramatsu-Asano S, Sunahori-Watanabe K,

Zeggar S, Katsuyama E, Mukai T, Morita Y,

Wada J. Deletion of Mir223 Exacerbates Lupus

Nephritis by Targeting S1pr1 in Faslpr/lpr Mice.

Front Immunol. 2021;11:616141. https://doi.

org/10.3389/fimmu.2020.616141.

25. Barrett JP, Knoblach SM, Bhattacharya

S, Gordish-Dressman H, Stoica BA,

Loane DJ. Traumatic Brain Injury In-

duces cGAS Activation and Type I In-

terferon Signaling in Aged Mice. Front

Immunol. 2021;12:710608. https://doi.

org/10.3389/fimmu.2021.710608.

26. Chuang HC, Chen MH, Chen YM, Yang HY,

Ciou YR, Hsueh CH, et al. BPI overexpres-

sion suppresses Treg differentiation and in-

duces exosome-mediated inflammation in

Effect of Qinggan Dongyin on T lymphocytes 281

Vol. 66(3): 269 - 281, 2025

systemic lupus erythematosus. Theranos-

tics. 2021;11(20):9953-9966. https://doi.

org/10.7150/thno.63743.

27. Sun JK, Zhang WH, Chen WX, Wang X,

Mu XW. Effects of early enteral nutri-

tion on Th17/Treg cells and IL-23/IL-17

in septic patients. World J Gastroente-

rol. 2019;25(22):2799-2808. https://doi.

org/10.3748/wjg.v25.i22.2799.

28. Lourenço JD, Teodoro WR, Barbeiro

DF, Velosa APP, Silva LEF, Kohler JB,

et al. Th17/Treg-Related Intracellular

Signaling in Patients with Chronic Obs-

tructive Pulmonary Disease: Compari-

son between Local and Systemic Respon-

ses. Cells. 2021;10(7):1569. https://doi.

org/10.3390/cells10071569.

29. Li J, Zhao J, Chai Y, Li W, Liu X, Chen Y. Astra-

galus polysaccharide protects sepsis model rats

after cecum ligation and puncture. Front Bioeng

Biotechnol. 2022;10:1020300. https://doi.

org/10.3389/fbioe.2022.1020300.