Invest Clin 66(3): 282 - 300, 2025 https://doi.org/10.54817/IC.v66n3a05

Corresponding author: Hongmei Qiu, 1882 Zhonghuan South Road, Nanhu District, Jiaxing 314001, Zhejiang,

China. Email: j0907ysxk@hotmail.com

MiR-451 ameliorates red blood cell storage

damage and macrophage polarization-

mediated transfusion immunity

by regulating the AMPK/mTOR signalling

pathway.

Xuechun Wang1, Xingxing Chen2, Hong Zhou1, Lingzhi Chen1,

Hongyun Wang3 and Hongmei Qiu1

1Department of Blood Transfusion, Jiaxing First Hospital, Jiaxing, Zhejiang, China.

2Department of Blood Donation Service, Jiaxing Blood Center, Jiaxing, Zhejiang, China.

3Department of Blood Supply Service, Jiaxing Blood Center, Jiaxing, Zhejiang, China.

Keywords: microRNA miR-451; ATF2; AMP-activated protein kinases/mTOR pathway;

erythrocytes; blood preservation macrophages.

Abstract. Red blood cells (RBCs) undergo a series of structural and function-

al changes during storage, and miR-451 is crucial for maintaining homeostasis of

RBCs. Inflammatory factors and miR-451 expression in whole blood at different

storage times were detected by ELISA and qRT-PCR. THP-1 cells were induced into

M0 macrophages. Subsequently, miR-451 mimics, miR-451 inhibitor, and activat-

ing transcription factor 2 (ATF2) were transfected into the cells, followed by the

application of compound C. Macrophages were then polarized to the M1 pheno-

type. Macrophage markers were discovered through flow cytometry and Western

blot. The adenosine monophosphate-activated protein kinase (AMPK)/mammalian

target of rapamycin (mTOR) pathway protein levels were detected using Western

blot. Finally, a mouse model of traumatic hemorrhagic shock was constructed, and

blood transfusion and tail vein injection of agomir-451 were performed. The levels

of M1 macrophage markers and inflammatory factors were detected by flow cytom-

etry and ELISA, respectively. When the human whole blood storage time was 21 d

and 35 d, the expression of miR-451 decreased, and the proinflammatory factor

contents increased. When miR-451 was overexpressed, proinflammatory cytokines

and M1 macrophage markers’ expression in THP-1 cells were reduced, p-AMPK level

was increased, and p-mTOR level was decreased. After overexpression of ATF2 or

compound C, proinflammatory factors and M1 macrophage markers in THP-1 cells

increased, and p-AMPK and p-mTOR expression reversed. Overexpression of miR-

451 also inhibited macrophage M1 polarization and inflammation in shock mice.

miR-451 inhibits ATF2-regulated AMPK/mTOR pathway, inhibits macrophage M1

polarization and inflammation, and improves RBC storage damage.

miR-451 improves red blood cell storage lesions 283

Vol. 66(3): 282 - 300, 2025

MiR-451 mejora el daño de almacenamiento de glóbulos rojos

y la inmunidad de transfusión mediada por la polarización

de macrófagos mediante la regulación de la señalización

AMPK/mTOR.

Invest Clin 2025; 66 (3): 282 – 300

Palabras clave: micro ARN miR-451; ATF2; proteínas quinasa activadas por AMP/mTOR;

eritrocitos; conservación de la sangre; macrófagos.

Resumen. Los glóbulos rojos (RBC) sufren una serie de cambios estructurales

y funcionales durante el almacenamiento, y miR-451a es crucial para la homeosta-

sis de los glóbulos rojos. MiR-451 puede mantener la homeostasis de los glóbulos

rojos. Los factores inflamatorios y la expresión de miR-451 en sangre completa a

diferentes tiempos de almacenamiento fueron detectados por ELISA y qRT-PCR.

Las células THP-1 fueron inducida a macrófagos M0, luego el miR-451 imitador y el

miR-451inhibidor, junto al factor de activación de transcrpción 2 (ATF2) se trans-

fectaron a las células, seguido de la aplicación del compuesto C. Los macrófagos son

entonces polarizados a tipo M1. Los marcadores de macrófagos fueron evaluados

mediante citometría de flujo y Western blot. Los niveles de proteínas de la vía de la

proteína quinasa-activada por monofosfato de adenosina (AMPK)/blanco de la rapa-

micina en mamíferos (mTOR) fueron detectados usando Western blot. Finalmente,

se construyó un modelo de shock hemorrágico traumático en ratón , y se realizó

transfusión sanguínea e inyección en vena de la cola de agomir-451. Los marcadores

de macrófagos tipo M1 y los niveles de factores inflamatorios fueron examinados por

citometría de flujo y ELISA, respectivamente. Cuando el tiempo de almacenamiento

de sangre total humana fue de 21 y 35 días, la expresión de miR-451 disminuyó y

el contenido de factor pro-inflamatorio aumentó. Cuando mir-451 se superexpresa,

la expresión de citocinas proinflamatorias y marcadores de macrófagos de tipo M1

en las células THP-1 disminuye, los niveles de p-AMPK aumentan y los niveles de

p-mTOR disminuyen. La superexpresión de ATF2 o la aplicación del compuesto C

aumenta el factor proinflamatorio y los marcadores de macrófagos de tipo M1 en

las células THP-1, y la expresión de p-AMPK y p-mTOR se revierte. La sobreexpresión

de miR-451 también inhibe la la polarización M1 y la inflamación en macrófagos

de ratones en shock. El miR-451 inhibe el ATF2 para regular la vía AMPK/mTOR,

inhibe la polarización e inflamación por los macrófagos M1 y mejora el daño de al-

macenamiento de RBC.

Received: 06-03-2025 Accepted: 30-06-2025

INTRODUCTION

Red blood cell (RBC) transfusion is

a standard treatment that saves lives. The

unique cell structure of RBCs enables them

to have good deformability and the ability

to transport O2. This structure also makes

RBCs highly susceptible to environmental

influences and has a short lifespan, making

them prone to harmful lesions in vitro. At

284 Wang et al.

Investigación Clínica 66(3): 2025

present, the primary storage method of RBC

is to suspend them in different components

of RBC preservation solution 1. However,

RBC storage is accompanied by a series of

biochemical and morphological changes,

which eventually lead to the decline of RBC

quality and function, which is called RBC

storage damage 2. There may be a potential

negative relationship between RBC stor-

age time and blood transfusion outcome,

which will reduce the effect of clinical blood

transfusion treatment and may even lead to

the occurrence of serious adverse events of

blood transfusion 3. Therefore, RBC stor-

age damage has become a key area of blood

transfusion safety. Prolonging RBC storage

time and effectiveness, and obtaining high-

er quality RBCs to meet clinical blood use

needs, is of great significance.

Studies have found that infusion of red

blood cells with extended storage time can

cause persistent lung inflammation and in-

jury 5. The extracellular vesicles produced by

stored red blood cells can induce the pro-

duction of tumor necrosis factor-α (TNF-α),

interleukin (IL) -6 and IL-8, resulting in a

strong inflammatory response in the recipi-

ent. The vesicles also contain a large amount

of coagulation substances, which alter the

recipient’s coagulation function, potentially

leading to adverse outcomes from red blood

cell transfusion. In addition, the storage of

red blood cells will produce a large amount

of free iron ions, which will activate macro-

phages to release a large number of inflam-

matory substances after infusion into the

human body, potentially leading to a system-

ic inflammatory response in the recipient 7.

It can be inferred that inhibition of inflam-

mation is significant in improving red blood

cell storage damage.

MicroRNA (miRNA) plays a role in regu-

lating gene expression throughout biologi-

cal evolution 8. In 2010, for the first time,

researchers reported the miRNA differential

map of stored RBC, which provided a new

idea for a comprehensive understanding of

RBC storage damage, and proposed that

there may be miRNA regulatory pathways in

stored RBC 9M. Later, researchers disclosed

the protective impact of miR-196a on stored

RBC decay 10, and the up-regulation of miR-

203 expression can prolong the storage time

of RBC by inhibiting apoptosis 11. However,

so far, little is known about the exact mecha-

nism of abnormal expression of miRNAs in

RBC storage damage. miR-451 is the only

miRNA found so far that does not depend

on the Dicer enzyme for maturation. miR-

451 is the most expressed miRNA in mature

RBC, and its abnormal expression is also as-

sociated with a variety of blood diseases 12.

In stored RBC, miR-451 is also abnormally

up-regulated 13. In conclusion, miR-451 may

have an improvement effect on RBC storage

damage.

miR-451 can regulate cell function

through adenosine monophosphate-acti-

vated protein kinase (AMPK) / mammalian

target of rapamycin (mTOR) pathway 14. It

is known that adenosine triphosphate (ATP)

consumption and Ca2+ accumulation occur

in stored RBCs. AMPK can activate and reg-

ulate downstream target phosphorylation

through the above process 15. The survival

rate of RBC transfusion is negatively related

to deformability-related phosphorylation 16.

mTOR is a highly conserved serine/threo-

nine protein kinase. mTOR, as a key signal-

ling pathway for cell metabolism regulation,

can regulate biological macromolecules as

cells’ cornerstone 17. In addition to the plas-

ma membrane and cytoplasm, mature RBCs

have no other organelles, cannot carry out

aerobic oxidation of sugar, and can only use

glycolysis for energy supply 18. In addition to

the plasma membrane and cytoplasm, ma-

ture RBCs have no other organelles, cannot

carry out aerobic oxidation of sugar, and can

only use glycolysis for energy supply. Inhi-

bition of the mTOR signalling pathway can

downregulate G-6-PD to regulate changes in

cell biological function 20. In recent years,

studies have found that exposure to drugs

such as mTOR inhibitors can affect RBC

number and redox metabolism, affect the

miR-451 improves red blood cell storage lesions 285

Vol. 66(3): 282 - 300, 2025

quality of RBC storage and the efficacy after

blood transfusion 21, suggesting that miR-

451 may affect RBC metabolism by regulat-

ing AMPK/mTOR signalling and participate

in RBC storage damage.

In summary, we propose a hypothesis

that miR-451 regulates the AMPK/mTOR

pathway and is vital for RBC storage dam-

age and transfusion-related complications.

In this study, the miR-451 level in long-term

stored blood was detected, and then its ex-

pression was interfered with. The macro-

phage polarization and inflammatory re-

sponse indexes were measured, and the role

of the AMPK/mTOR pathway was explored.

The goal of this study is to prove that miR-

451 can regulate the AMPK/mTOR sig-

nalling pathway to improve red blood cell

storage damage and provide a theoretical

basis for improving RBC storage damage and

blood transfusion complications.

METHODS

Sample source

Whole blood was obtained from 20

healthy donors. All donors have read and

signed the informed consent. The Medical

Ethics Committee of Jiaxing First Hospital

has approved this study. Four hundred mL of

whole blood was collected from each donor,

and processed and stored according to the

operation specifications of the blood sta-

tion. Whole blood was collected in citrate-

phosphate-glucose solution (CPD; 3 mg/mL

citric acid, 26.30 mg/mL sodium citrate,

2.22 mg/mL sodium dihydrogen phosphate,

and 25.51 mg/mL glucose), and a portion of

the blood was taken out for immediate de-

tection. The expression levels of inflamma-

tory factors and miR-451 in the whole blood

were detected by enzyme-linked immuno-

sorbent assay (ELISA) and quantitative real-

time polymerase chain reaction (qRT-PCR).

The remaining blood was sub-packed in a 1.7

mL blood bag catheter and stored at 4 ℃ for

up to 35 days.

Human monocytic leukemia THP-1 cells

were purchased from Punosai Life Technolo-

gy Co., Ltd. (CL-0233, Wuhan, China). THP-

1 cells were cultured in RPMI 1640 medium

(L220KJ, BasalMedia) containing 10% fetal

bovine serum and 1% penicillin-streptomy-

cin (S110JV, BasalMedia, Shanghai, China)

at 37 ℃ and 5% CO2. THP-1 cells in logarith-

mic growth phase were taken for subsequent

experiments.

Macrophage differentiation

THP-1 cells were stimulated with 100

ng/mL PMA (IP1010, Solarbio) for 48 h to

induce M0 macrophages. When the cells

were transformed from suspension to a fu-

siform or irregular adherent state, THP-

1 cells were induced to differentiate into

macrophages 22. M0 macrophages were then

treated with 100 ng/mL LPS (lipopolysac-

charides, LPS, IL2020, Solarbio) and 20 ng/

mL IFN-γ (interferon-gamma, IFN-γ, P00028,

Solarbio) for 24 h to induce the polarization

of M0 macrophages to M1 macrophages 23.

Macrophage treatment and transfection

M0 macrophages in logarithmic growth

phase were inoculated in 6-well cell culture

plates. The cells were randomly divided into

the following groups: PMA group, M1 macro-

phage (LPS+IFN-γ) group, miR-451 mimics

(mimics) group, miR-451 inhibitor (inhibi-

tor) group, activating transcription factor

2 (ATF2) group, LPS+IFN-γ+miR-451 mim-

ics (LPS+IFN-γ+mimics) group, LPS+IFN-

γ+ATF2 group, and the corresponding neg-

ative control group. The cells in the PMA

group were routinely cultured without any

operation; miR-451 mimics, miR-451 in-

hibitor, ATF2 and corresponding negative

controls were transfected into M0 macro-

phages according to the instructions of Li-

pofectamine 3000 (L3000001, Invitrogen,

Austin, TX, USA) kit. Then, the transfected

or untransfected M0 macrophages were

polarized to M1 macrophages by LPS and

IFN-γ.

286 Wang et al.

Investigación Clínica 66(3): 2025

Macrophage markers were detected

by flow cytometry (FCM)

Cells were collected, resuspended into

a single cell suspension, stained with polar-

ization markers (M0 macrophages: 5 μL an-

ti-human CD68-PE (333807, Biolegend); M1

macrophages: 5 μL anti-human CD86-FITC

(374203, Biolegend)), incubated in a refrig-

erator at 4 ℃ for 30 min, and fixed with 500

μL paraformaldehyde for flow cytometry (BD

FACSCaliburTM, BD Biosciences, San Jose,

CA, USA). The Cell Quest software was used

for data analysis.

CCK-8 assay

After the polarization of M1 macro-

phages was completed, the medium was re-

placed with a medium containing 10% CCK-

8 reagent and cultured for two hours. The

OD450 nm was detected by a microplate reader

(MultiskanGo1510, Thermo, Massachusetts,

USA), and the cell viability was calculated

according to the formula.

Bioinformatics analysis

The potential target genes of

miR-451 were screened by miRWalk

(http://129.206.7.150/), TargetScan (https:

//www.targetscan.org/vert_80/), mirRDB

(https://mirdb.org/), and ENCORI/starBase

(https://rnasysu.com/encori/) databases.

The binding site of miR-451 to ATF2 was pre-

dicted by the TargetScan database.

Dual-luciferase assay

WT-ATF2 or MUT-ATF2 targeted binding

site fragments were ligated to the pmirGLO

vector to construct a dual luciferase vector,

and then transfected with miR-451 mimics,

NC or mimics into M0 macrophages using

transfection reagents. After 48 h, the cells

were digested with trypsin and transferred

to a 96-well microplate, and then the lucifer-

ase activity of each group was measured us-

ing the Promega dual Glo® luciferase assay

system.

qRT-PCR

Total RNA was extracted from the whole

blood of 20 healthy donors using TransZol

Up (ET111-01-V2, TRANS, Beijing, China).

Using the TransScript® Green One-Step

qRT-PCR SuperMix kit (AQ211-01, TRANS),

RNA was reversely transcribed into cDNA

and subjected to qRT-PCR amplification. The

data were quantified by the 2-ΔΔCt method.

GAPDH and U6 were used as internal refer-

ences.

Primer sequences: miR-451: F: TCCGATT-

GAGTCATTACCAT; R: GTGCAGGGTCCGAG-

GT; ATF2: F: AATTGAGGAGCCTTCTGTTG-

TAG; R: CATCACTGGTAGTAGACTCTGGG;

GAPDH: F: 5’-TGGCCTTCCGTGTTCCTAC-3’;

R: 5’-GAGTTGCTGTTGAAGTCGCA-3’; U6:

F: 5’-CAGGTCTCCAAGACGACATAGA-3’; R:

5’-CGCCTTTTCGATTCATGTACTGC-3’.

Western blot (WB)

Ten μM Compound C, an AMPK inhibi-

tor, was applied at the same time as mim-

ics transfection, followed by induction of M1

macrophage polarization. Then, the cells

of each group were collected, and the total

protein was extracted by adding the lysate.

The protein concentrations were detected

using the BCA kit (PC0020, Solarbio), and

the protein was denatured at high tempera-

ture. The appropriate concentration of the

gel was prepared, and electrophoresis was

performed after loading the sample. The gel

was then immersed in the transfer solution

and transferred to the PVDF membrane at

a low temperature. At the end of the incu-

bation, the protein band was immersed in

a rapid blocking solution for 30 min. CD86

(ab239075, abcam), p-mTOR (ab109268,

abcam), iNOS (ab283655, abcam), TNF-α

(ab215188, abcam), ATF2 (ab239361, ab-

cam), p-AMPK (ab92701, abcam), AMPK

(ab271188, abcam), mTOR (ab134903, ab-

cam) and GAPDH (ab128915, abcam) pri-

mary antibodies were incubated overnight at

4 ℃. The corresponding secondary antibody

was re-incubated, followed by PBST wash-

miR-451 improves red blood cell storage lesions 287

Vol. 66(3): 282 - 300, 2025

ing. The gel was then exposed to lumines-

cent liquid (G2161, Servicebio) and imaged

using the gel imaging system (SCG-W1000,

Servicebio). Image J software was used to

analyze the protein gray value. Finally, the

results were saved and analyzed.

Animal experiment

Sixty-four SPF 6-week-old male

C57BL/6 mice, weighing (20±2) g, were

purchased from Vital River Laboratory Ani-

mal Technology Co., Ltd. (Beijing, China).

The mice were fed in a (22±2) ℃, 50%-60

% relative humidity, light/dark 12h/12h en-

vironment. During the feeding period, the

mice were fed freely, and the experimental

process was started after one week of adap-

tive feeding. All experiments were conducted

following guidelines approved by animal pro-

tection organizations and the Jiaxing First

Hospital committee.

After anesthesia with 1% pentobarbital

sodium, the mice were subjected to cardiac

puncture and sterile blood collection. Thir-

ty-two mL of whole blood from 40 mice was

mixed with 5.2 mL of CPDA-1 anticoagulant

(14% CPDA-1 was eventually used for storage),

and the whole blood of the mice was stored

for 14 days. All procedures in the blood col-

lection process were performed under strict

aseptic conditions. Whole blood was mixed

in a 50 mL sterile tube (Corning, New York,

USA) and stored in the dark at 4 ℃.

The remaining 24 mice were used to

establish a mouse model of traumatic hem-

orrhagic shock 24, and the stored blood sam-

ples were injected into the shocked mice

through the tail vein. Shock-mice were ran-

domly divided into four groups with six mice

in each group: group 1 without exchange

transfusion + equal amount of normal sa-

line (Control), group 2 exchange transfusion

+ equal amount of normal saline (Model),

group 3 exchange transfusion + agomir-NC

(agomir-NC) and group 4 exchange transfu-

sion + agomir-451 (agomir-451). After the

exchange transfusion was completed, the

mice were immediately injected with five

nmol agomir-NC and agomir-451 via the tail

vein. The levels of macrophage polarization

markers and inflammatory cytokines were

evaluated after 72 h.

After 72 hours of treatment, the mice

were sacrificed, and the lymph node tissues of

the mice in each group were fully ground and

digested with collagenase (C8160, Solarbio) at

37 ℃ for 0.5 h. The DMEM medium contain-

ing 20% fetal bovine serum was added to the

mixture to terminate the digestion entirely.

After being blown, it was passed through a 70

μm sieve and centrifuged to prepare a single

cell suspension. 100 μL suspension was added

with CD86 antibody, incubated at 4 ℃ for 30

min in the dark, washed three times with PBS

solution, and each tube was resuspended with

200 μL PBS solution and detected by flow cy-

tometry.

ELISA

The blood sample was transferred to a

sterile centrifuge tube, and the supernatant

was collected after centrifugation. IL-10

(ab34843, abcam), TNF-α (ab183218, ab-

cam), IL-6 (ab11449, abcam; sEKM-0007, So-

larbio), IL-1β (ab2105, abcam; SEKM-0002,

Solarbio), IL-12 (ab9992, abcam), inducible

nitric oxide sythase (iNOS, ab205529, ab-

cam), IL-18 (SEKM-0019, Solarbio), CCL22

(SEKM-0110, Solarbio) and transforming

growth factor-β (TGF-β, SEKM-0035, Solar-

bio) levels were measured by ELISA. A to-

tal of 90 μL of sample serum and standard

were added to the reaction well, and 10 μL of

horseradish peroxidase-labelled antibody was

added. After mixing, the reaction well was

sealed with a sealing membrane and incu-

bated for two hours in the dark. Washed with

detergent three times and dried on absorbent

paper. 100 μL chromogenic agent TMB solu-

tion was added, the reaction hole was sealed

with a sealing film, and the reaction was incu-

bated for 20 min. Fifty μL of stop solution was

added, the OD value was immediately mea-

sured after mixing, and the corresponding

concentration of the sample was determined

according to the standard curve.

288 Wang et al.

Investigación Clínica 66(3): 2025

Statistical analysis

The Prism software (Graphpad 9.0) was

used for statistical analysis, and the data with

normal distribution were expressed as mean

± standard deviation. One-way ANOVA analy-

sis was used for comparison among multiple

groups. The Pearson correlation was per-

formed for fold-change in the level of miR-

451 and expression level of inflammatory fac-

tors (IL-1β, IL-6, IL-12, and TNF-α). p<0.05

was considered statistically significant.

RESULTS

The levels of inflammatory factors

and the expression of miR-451 in whole

blood storage

More and more studies have shown that

RBCs will age or even undergo apoptosis af-

ter two weeks of storage due to biochemi-

cal and morphological changes. Therefore,

we tested the stored whole blood samples

on days 0, 21 and 35. We evaluated the fold-

change in miR-451 levels and the expression

levels of inflammatory factors (IL-1β, IL-6,

IL-12, and TNF-α), which are typically re-

leased or overexpressed upon macrophage

M1 type activation, using Pearson correla-

tion analysis. This analysis revealed a corre-

lation between them (Table 1). The results

showed that inflammatory factors IL-1β, IL-

6, IL-12 and TNF-α contents were markedly

increased in the whole blood samples stored

for 21 d and 35 d, and the inflammation level

progressively rose with the increase of stor-

age time (Fig.1A-D). Simultaneously, miR-

451 expression was significantly decreased in

whole blood samples stored for 21 d and 35 d

(Fig. 1E). Notably, miR-451 had a protective

effect on RBC storage damage. Compared

with fresh blood samples, a large number of

inflammatory factors accumulate in long-

term stored blood samples. These inflamma-

tory factors are related to M1 macrophages.

Therefore, we speculate that miR-451 may

be involved in improving RBC storage loss by

regulating macrophage M1 polarization and

mediating inflammatory response.

Table 1. Statistical analysis of correlations between levels of miR-451 and inflammatory cytokines.

qIL-1βqIL-6 qIL-12 qTNF-α

miR-451 Pearson Correlation -.444* -.519* -.450* -.414

Sig. (2-tailed) 0.049 0.019 0.046 0.069

n=20

qIL-1β = qIL-1β Day 35/ qIL-1aDay 0,qIL-6 = IL6 Day 35/IL6 Day 0, qIL-12 = IL-12 Day35/ IL-12 Day 0, qTNF-α

= qTNF-α Day 35/ qTNF-α Day 0.

Fig. 1. Inflammatory factor contents and miR-451 expression in whole blood storage.

A-D: IL-1β, IL-6, IL-12 and TNF-α levels in human whole blood samples stored for 0 d, 21 d and 35 d were

detected by ELISA, which were significantly increased at 21 d and 35 d.

E: miR-451 level in human whole blood samples stored for 0 d, 21 d and 35 d was detected by qRT-PCR. It can be

seen that it was signicantly reduced at 21 d and 35 d.

n=20, *p<0.05, **p<0.01 vs 0 d group vs 0 d group, one-way ANOVA was used for statistical analysis.

miR-451 improves red blood cell storage lesions 289

Vol. 66(3): 282 - 300, 2025

miR-451 attenuates macrophage M1

polarization and inhibits the release

of inflammatory factors

To clarify the specific function of

miR-451 on improving RBC storage dam-

age, this study used PMA to induce THP-1

cells into M0 macrophages, and detect-

ed the expression of its marker CD68 by

FCM. The results showed that PMA could

significantly increase CD68-positive cells

(Fig.2A-B), suggesting that M0 macro-

phages were successfully induced. Then,

M0 macrophages were induced to polarize

into M1 macrophages by LPS and IFN-γ,

and the marker CD86-positive cells were

significantly increased by FCM (Fig.2C-

D), indicating that M1 macrophages were

successfully polarized. miR-451 expres-

sion was obviously lessened in M1 macro-

phages (Fig.2E), suggesting that miR-451

may regulate macrophage polarization.

Therefore, we next transfected miR-451

mimics into M0 macrophages; miR-451

expression was notably increased (Fig.2F),

Fig. 2. miR-451 attenuates macrophage M1 polarization and inhibits the release of inflammatory factors.

A-B: M0 macrophage marker CD68 level was detected through FCM, and it was found that PMA could

significantly increase CD68-positive cells.

C-D: M1 macrophage marker CD86 level was detected through FCM, and it was found that LPS and IFN-γ

could significantly increase its expression.

E: miR-451 expression was discovered using qRT-PCR, and it was significantly decreased in M1 macrophages.

F: miR-451 mimics were transfected into M0 macrophages, and qRT-PCR detected the expression of

miR-451, and its high expression was observed.

G-H: The transfected M0 macrophages were polarized into M1 macrophages, and FCM detected the ex-

pression of CD86. It was found that the expression of miR-451 was markedly reduced after overexpression.

I: CCK8 was used to detect the proliferation of M1 macrophages, and the cell viability was significantly

reduced after miR-451 overexpression.

J-M: Proinflammatory factors IL-1β, IL-6, IL-12 and TNF-α contents in the culture medium supernatant

were discovered by ELISA, and they were significantly reduced after miR-451 overexpression.

N-Q: M1 macrophage markers CD86, iNOS and TNF-α levels were detected by WB, and they were signi-

ficantly reduced after miR-451 overexpression.

n=3, *p<0.05, **p<0.01, ***p<0.001 vs LPS+IFN-γ+mimics NC group, one-way ANOVA was used for

statistical analysis.

290 Wang et al.

Investigación Clínica 66(3): 2025

suggesting that miR-451 was significantly

overexpressed, that is, transfection was

successful. After transfection, the trans-

fected M0 macrophages were polarized

into M1 macrophages. It was found that

after overexpression of miR-451, the M1

macrophage marker CD86-positive cells

were significantly reduced (Fig. 2G-H),

and the cell viability was also significantly

reduced (Fig. 2I); that is, miR-451 can in-

hibit macrophage M1 polarization. At the

same time, ELISA also found that proin-

flammatory factors IL-1β, IL-6, IL-12 and

TNF-α contents in the medium superna-

tant were significantly decreased after

miR-451 overexpression (Fig. 2J-M), indi-

cating that miR-451 inhibited the release

of inflammatory factors. Finally, M1 mac-

rophage markers CD86, iNOS, and TNF-α

protein were also markedly reduced (Fig.

2N-Q). The above results indicate that

overexpression of miR-451 can attenuate

macrophage M1 polarization and inhibit

proinflammatory factor release.

miR-451 can target ATF2 expression

The target gene of miR-451 was screened

by various databases as ATF2, ENCORI/star-

Base targeting score≥1 (Fig. 3A). The expres-

sion of the ATF2 gene and ATF2 protein was

notably decreased after overexpression of miR-

451. After knocking down miR-451, ATF2 gene

expression and ATF2 protein level were signifi-

cantly increased (Fig. 3B-D), indicating that

miR-451 can downregulate ATF2. When miR-

451 was overexpressed, WT-ATF2 luciferase ac-

tivity was markedly reduced, but MUT-ATF2 lu-

ciferase activity was not affected (Fig.3E), and

its binding site is shown in Fig.3F. This further

confirmed the binding of miR-451 to ATF2. Fi-

nally, ATF2 protein level in M1 macrophages

was significantly increased (Fig. 3G-H).

Fig. 3. miR-451 can target ATF2 expression.

A: The potential target gene ATF2 of miR-451 was screened by miRWalk, TargetScan, mirRDB and EN-

CORI/starBase databases.

B: The expression level of the ATF2 gene was detected by qRT-PCR, which was decreased after miR-451

overexpression and increased after miR-451 knockdown.

C-D: WB detected ATF2 protein level, which declined after miR-451 overexpression and elevated after

miR-451 knockdown.

E: Dual luciferase assay showed that overexpression of miR-451 reduced WT-ATF2 luciferase activity.

F: The binding site of miR-451 and ATF2.

G-H: ATF2 level in M1 macrophages was discovered through WB, and it was significantly increased.

n=3, **p<0.01 vs mimics NC group; ##p<0.01 vs inhibitor NC group, one-way ANOVA was used for

statistical analysis.

miR-451 improves red blood cell storage lesions 291

Vol. 66(3): 282 - 300, 2025

miR-451 inhibits macrophage M1

polarization and proinflammatory

cytokine release by inhibiting ATF2

Next, ATF2 was overexpressed in this

study, and ATF2 gene expression and ATF2

protein level were significantly overex-

pressed in M0 macrophages (Fig. 4A-C),

indicating that ATF2 was successfully over-

expressed. Then we overexpressed miR-451

and ATF2 in M0 macrophages and polarized

them into M1 macrophages using LPS and

IFN-γ. Compared with miR-451 overexpres-

sion, miR-451 and ATF2 overexpression in-

creased CD86-positive cells (Fig. 4D-E), and

the protein levels of CD86, iNOS and TNF-α

were also notably raised (Fig. 4F-I). IL-1β,

IL-6, IL-12 and TNF-α contents in the su-

pernatant were significantly increased (Fig.

4J-M). ATF2 mitigated the inhibitory effect

of miR-451 on macrophage M1 polarization.

Combined with bioinformatics and miR-451

overexpression experiments, it was demon-

strated that miR-451 could target ATF2 to

attenuate macrophage M1 polarization and

inflammation.

miR-451 inhibits macrophage M1

polarization by inhibiting ATF2

and regulating AMPK/mTOR

signaling pathway

miR-451 can regulate cell function

through the AMPK/mTOR signalling path-

Fig. 4. miR-451 inhibits macrophage M1 polarization and proinflammatory cytokine release by inhibiting ATF2.

A-C: The overexpression level of ATF2 was detected by qRT-PCR and WB, and the gene expression and

protein level of ATF2 were significantly increased.

D-E: The transfected M0 macrophages were polarized into M1 macrophages, and the expression of CD86

was detected by FCM, which was significantly increased upon ATF2 overexpression.

F-I: CD86, iNOS and TNF-α levels were discovered through WB, and they were significantly increased

after ATF2 overexpression.

J-M: IL-1β, IL-6, IL-12 and TNF-α contents in the medium supernatant were discovered by ELISA, and

they were significantly increased after ATF2 overexpression.

n=3, *p<0.05, **p<0.01 vs mimics NC+Vector group; #p<0.05, ##p < 0.01 vs mimics+Vector group,

one-way ANOVA was used for statistical analysis.

292 Wang et al.

Investigación Clínica 66(3): 2025

way. In this study, AMPK inhibitor compound

C was used for intervention experiments.

p-AMPK protein levels were elevated, and

p-mTOR protein expression declined when

miR-451 was overexpressed. On this basis,

p-AMPK expression lessened and p-mTOR

expression increased after overexpression

of ATF2 and application of compound C

(Fig.5A-C), indicating that miR-451 regu-

lates AMPK/mTOR signalling pathway by

inhibiting ATF2. At the same time, CD86,

iNOS and TNF-α levels were markedly raised

after compound C intervention (Fig. 5D-

G), indicating that inhibition of the AMPK/

mTOR pathway could promote macrophage

M1 polarization. In conclusion, miR-451

attenuates macrophage M1 polarization

by targeting ATF2 to regulate the AMPK/

mTOR axis.

miR-451 regulates transfusion immunity

in mice infused with traumatic shock

Finally, this study established a mouse

model of traumatic hemorrhagic shock,

performed blood exchange operations, and

injected agomir-451 intravenously. In Mod-

el mice, the number of CD86-positive cells

increased, suggesting that macrophage M1

polarization occurred. After miR-451 overex-

pression, CD86-positive cells decreased (Fig.

6A-B), indicating that miR-451 can also in-

hibit macrophage M1 polarization in vivo. At

the same time, it was also found in the blood

that the contents of TNF-α, IL-6, iNOS, IL-18,

IL-1β, CCL22, and TGF-β increased in Model

mice, and significantly decreased after miR-

451 overexpression (Fig. 6C-I), indicating

that miR-451 can also inhibit inflammation

in vivo. In summary, miR-451 can regulate

Fig. 5. miR-451 inhibits macrophage M1 polarization by inhibiting ATF2 and regulating the AMPK/mTOR

signalling pathway.

A-C: WB was used to detect the expression of AMPK/mTOR pathway proteins. It was found that the level

of p-AMPK increased and p-mTOR protein decreased when miR-451 was overexpressed. On this basis,

ATF2 overexpression and application of compound C were significantly reversed.

D-G: CD86, iNOS and TNF-α levels were discovered through WB, and they were significantly increased

after compound C intervention.

n=3, **p<0.01 vs mimics NC+Vector group; ##p<0.01 vs mimics+Vector group, one-way ANOVA was

used for statistical analysis.

miR-451 improves red blood cell storage lesions 293

Vol. 66(3): 282 - 300, 2025

blood transfusion immunity in mice infused

with stored RBCs by inhibiting macrophage

M1 polarization and inflammation.

DISCUSSION

In recent years, with the continuous

improvement of medical level and surgical

volume, the demand for clinical blood is in-

creasing. At present, the primary source of

blood transfusion is still allogeneic stored

RBC. In recent years, RBC storage damage

has been the focus of blood transfusion stud-

ies. RBC is one of the most widely used blood

components in clinical practice. However,

RBC in the middle and late stages of infu-

sion storage is not without risk 25. Because

RBC is stored at sub-physiological pH and

temperature, a series of metabolic, oxidative

and physiological changes occur in RBC,

which are called RBC storage lesions. Many

of these changes increase with time, affect-

ing the overall quality standards, functional

integrity and in vivo survival of RBC infu-

sion. Some changes in the early storage pe-

riod (about 14 days) are reversible, but with

storage time extension, the damages are ir-

reversible 26.

Studies have confirmed that after RBC

is isolated, the low-temperature storage en-

vironment will lead to electrolyte imbalance,

metabolite accumulation, oxidative stress,

membrane damage, and ultimately lead to

storage damage 27. These changes damage

RBC metabolism, function, and viability.

However, the mechanism of RBC storage

damage is still unclear. The gene chip study

revealed that 109 miRNAs increased and 102

genes decreased during storage, when RBCs

were stored for 20 days compared with the

fresh group. Sarachana et al. 29 found four

microRNAs related to RBC storage dam-

age. RT-PCR analysis showed that these four

miRNAs were differentially expressed on

day 14 and day 28. Bioinformatics analysis

identified the potential targets and biologi-

cal functions of these miRNAs. Overexpres-

sion of miR-196a in human RBC cell lines

confirmed its protective effect on cell death

and ATP loss 29. It has been found that miR-

451 is the most expressed miRNA in mature

RBCs. At the same time, some studies have

Fig. 6. miR-451 infusion regulates transfusion immunity in mice with traumatic shock.

A-C: The expression of CD86 was detected by FCM, which was increased in Model mice and decreased

after miR-451 overexpression.

D-G: The blood inflammatory cytokines TNF-α, IL-6, iNOS, IL-18, IL-1β, CCL22 and TGF-β expressions

were detected by ELISA. It can be seen that they increased in Model mice and decreased after miR-451

overexpression.

n=6, **p<0.01 vs Control group; ##p<0.01 vs Model group, one-way ANOVA was used for statistical analysis.

294 Wang et al.

Investigación Clínica 66(3): 2025

reported that RBC microparticles can me-

diate the transmission of miR-451 to endo-

thelial cells and affect the results after RBC

transfusion 30, suggesting that miR-451 may

mediate RBC storage damage and may also

affect blood transfusion receptors through

microparticles, exosomes and other ways to

cause adverse transfusion events.

Studies have shown that the old RBCs

with a long storage period (≥ 2 weeks) re-

lease the most abundant heme content and

the most obvious damage-related molecular

pattern. Heme can amplify the LSP-induced

inflammatory response, and a large number

of old RBCs are infused into special patients,

such as those with traumatic hemorrhagic

shock and sepsis. The free heme will exceed

the body’s metabolic capacity and promote

the body’s inflammatory damage. It was

found that IL-1β, IL-6, IL-12 and TNF-α were

highly expressed in long-term stored whole

blood 31. Infusion of suspended, less white

RBCs can cause an increase in inflammato-

ry factors and initiate neutrophil activity.32

Therefore, it can be speculated that infusion

of long-term stored RBCs may cause explo-

sive release of inflammatory factors, and ul-

timately cause human anti-RBC allogeneic

immune response.

In addition to the role of oxygen sup-

plementation, RBCs also have apparent im-

munomodulatory effects 33, 34. Studies have

found that both RBC metabolites and sur-

face molecules have immunomodulatory

effects. For example, the metabolite heme

molecules can stimulate macrophages to in-

duce inflammatory responses and interfere

with RBC function 35. The CD47 molecule on

the surface of red blood cells acts as a ‘do

not eat me’ signal, which is directly involved

in the recognition and phagocytosis of red

blood cells by macrophages. 36. RBC immune

factor is one of the critical reasons for in-

effective infusion. At this stage, storage of

RBC can affect the inflammatory expression

of macrophages. The immune effect of RBC

has attracted attention in recent years, and

RBC can produce a variety of immunomodu-

latory substances during storage 26. Its mo-

lecular mechanism is complex and has not

been fully elucidated.

Macrophages are key cell populations

associated with the body’s innate immune

response, which not only affect the body’s

immune function, but also affect the me-

tabolism of RBC 37. Macrophages can dif-

ferentiate into M1 and M2 types, which are

two types of cell populations with different

functions. This process is called macrophage

polarization 38, 39. M1 macrophages (mainly

expressing cell membrane proteins such as

CD86, CD80 and MHC-II) secrete proinflam-

matory response factors, while M2 macro-

phages (mainly expressing cell membrane

proteins such as CD206 and CD103) secrete

anti-inflammatory cytokines to exert anti-

inflammatory effects 40. M1 macrophages

can increase IL-1β and TNF-α contents, ag-

gravate host cell damage and hinder tissue

repair. In the inflammatory environment,

red blood cell distribution width (RDW)

increased compared with a typical environ-

ment, and inflammation had a particular

effect on RBCs, maintaining the normal

morphology 41. In summary, the polarization

of macrophages presents different immune

functions, and M1 and M2 types may affect

the survival and proliferation of RBC.

This study found that IL-1β, IL-6, IL-

12 and TNF-α contents were significantly

elevated in whole blood samples stored for

21 and 35 days. However, the miR-451 lev-

el was significantly decreased. The Pearson

correlation analysis showed that there was a

correlation between miR-451 and M1 mac-

rophages, suggesting that miR-451 may be

involved in RBC storage damage by regulat-

ing macrophage polarization-mediated in-

flammatory response. To this end, this study

first used PMA to induce THP-1 cells into M0

macrophages, and then polarized M0 mac-

rophages into M1 macrophages by LPS and

IFN-γ, and the miR-451 expression was sig-

nificantly reduced in M1 macrophages. Next,

this study transfected miR-451 mimics into

M0 macrophages and then polarized them

miR-451 improves red blood cell storage lesions 295

Vol. 66(3): 282 - 300, 2025

into M1 macrophages. It was found that the

activity of M1 macrophages was declined,

and the markers CD86, iNOS expression and

inflammatory factors IL-1β, IL-6, IL-12, and

TNF-α contents were significantly reduced.

In summary, the overexpression of miR-451

can attenuate macrophage M1 polarization

and restrain the release of proinflammatory

factors.

In this study, ATF2 was identified as a

potential target gene of miR-451. Overex-

pression of miR-451 reduced ATF2 levels,

while knockdown of miR-451 increased ATF2

levels. The two have binding sites, indicating

that miR-451 can target and downregulate

ATF2. When harmful substances stimulate

macrophages, G protein-coupled receptors

and non-G protein-coupled receptors are

activated, leading to increased phosphoryla-

tion of MAPK protein 42. This MAPK then

enters the nucleus and activates the nuclear

transcription factor ATF2, which promotes

the secretion and release of proinflamma-

tory cytokines IL-6, IL-1β, and TNF-α 43. Si-

multaneously, this study also found that the

level of ATF2 protein in M1 macrophages was

notably increased. After overexpressing ATF2

in M0 macrophages, they were polarized into

M1 macrophages. Compared to the overex-

pression of miR-451 alone, ATF2 overexpres-

sion increased the levels of M1 macrophage

markers CD86, iNOS, and inflammatory fac-

tors IL-1β, IL-6, IL-12, and TNF-α. Overall,

miR-451 targets ATF2 to reduce macrophage

M1 polarization and inflammation.

As a cell energy sensor, AMPK is respon-

sible for regulating cell energy and material

metabolism. mTOR is mainly involved in cell

growth, proliferation and metabolism. AMPK

is also an important upstream regulator of

mTOR 44. AMPK is an enzyme complex that

is crucial for macrophage polarization and

inflammation. Activation of the AMPK sig-

nalling pathway can not only reduce inflam-

matory response in adipose tissue of obese

mice, but also inhibits macrophage M1 po-

larization 45,46. It is known that protein ki-

nase B and the downstream signalling mol-

ecule mTOR play the key roles in regulating

macrophage polarization. mTOR is activated

by phosphorylation and exists in the form

of mTOR complex mTORC1 and mTORC2

in cells. Inhibition of mTOR causes macro-

phages to polarize to the proinflammatory

phenotype M1 47. Activation of mTORC1 may

lead to a decrease in the anti-inflammatory

phenotype M2 polarization 48. The M1 polar-

ization of alveolar macrophages is consid-

ered to be essential for the pathogenesis of

transfusion-related acute lung injury 49. Mac-

rophage cells undergo functional changes

and severe reactions upon ingesting transfu-

sion RBC microparticles 50, suggesting that

miR-451 may regulate macrophage polar-

ization by modulating the mTOR signalling

pathway, thereby mediating inflammatory

responses and contributing to the promo-

tion of post-transfusion complications. This

study showed that p-AMPK protein levels

rose and p-mTOR protein expression lowered

when miR-451 was overexpressed. When

ATF2 was overexpressed and the AMPK in-

hibitor compound C was applied, the protein

level of the AMPK/mTOR pathway was signif-

icantly reversed. In addition, this study also

found that M1 polarization of macrophages

increased significantly after compound C

intervention. Overall, miR-451 could tar-

get ATF2 to regulate the AMPK/mTOR axis

to attenuate macrophage M1 polarization

and participate in the immune response of

stored RBCs.

Clinical practice shows that both im-

mune-related and non-immune-related fac-

tors during RBC transfusion can cause ad-

verse reactions to blood transfusion. These

adverse reactions are closely related to RBC

transfusion. RBC storage damage is closely

associated with the incidence of adverse con-

sequences of blood transfusion. Infusion of

suspended RBC with ‘storage damage’ will

increase the incidence of adverse transfu-

sion reactions and mortality 51. Infusion of

stored RBCs not only damages the oxygen-

ation capacity of tissues, but also the RBCs

entering the body react with macrophages

296 Wang et al.

Investigación Clínica 66(3): 2025

to become injury or risk-related molecules,

which further activate the innate immune

response and lead to the damage of corre-

sponding normal tissues or organs 52. Finally,

this study found that M1 macrophages and

inflammatory factors were significantly in-

creased in mice undergoing infusion, while

miR-451 overexpression reduced M1 macro-

phages and inflammatory factor levels.

In summary, the data indicated that

the inhibition of ATF2 by targeting miR-451

regulates the AMPK/mTOR pathway, which

suppresses the polarization of macrophages

to the M1 phenotype and reduces the in-

flammatory response. This process, in turn,

diminishes the damage to red blood cells

(RBCs) during storage and lessens the im-

mune response triggered by the infusion of

stored RBCs (see Fig. 7). This study offers a

new approach and methodology for decreas-

ing RBC storage damage. However, research

on RBCs should extend beyond their physi-

ological roles; they should not be viewed

solely as cells responsible for supplying oxy-

gen. The immune regulation of stored RBCs

may be a key factor in adverse infusion reac-

tions, and changes in macrophage function

are a significant aspect of this immune regu-

lation. Focusing on the immune function of

macrophages is a vital direction for studying

the immune mechanisms underlying adverse

infusion reactions. Nevertheless, consider-

ing the complexity and diversity of immune

responses following infusion, our research

team will further design and explore relevant

research paths.

Acknowledgment

None.

Consent to publish

The manuscript has neither been previ-

ously published nor is it under consideration

by any other journal. The authors have all ap-

proved the content of the paper.

Consent to participate

We secured a signed informed consent

form from every participant.

Ethic approval

The Jiaxing First Hospital Committee

approved this study.

Funding

Hospital-Level Research Project of Jiax-

ing First Hospital (2024-YB-067).

Conflicts of interest

The authors declare that there are no

conflicts of interest.

ORCID number of authors

• Xuechun Wang (XW):

0009-0001-8441-5857

• Xingxing Chen (XC):

0009-0003-8894-7409

• Hong Zhou (HZ):

0009-0000-5176-7736

• Lingzhi Chen (LC):

0009-0006-1375-0056

• Hongyun Wang (HW):

0009-0000-1632-0752

• Hongmei Qiu (HQ):

0009-0003-5585-5903

Author contribution

XW: Edited and refined the manuscript

with a focus on critical intellectual contribu-

tions. XC, HZ: Developed and planned the

Fig. 7. miR-451-targeted inhibition of ATF2 to

regulate AMPK/mTOR pathway, inhibit

macrophage M1 polarization, and impro-

ve RBC storage damage and transfusion

immunity.

miR-451 improves red blood cell storage lesions 297

Vol. 66(3): 282 - 300, 2025

study, performed experiments, and interpret-

ed results.LC, HW: Participated in collecting,

assessing, and analyzing the data. Made sig-

nificant contributions to data interpretation

and manuscript preparation. XW, HQ: Provid-

ed substantial intellectual input during the

drafting and revision of the manuscript.

REFERENCES

1. Zingg SW, Schuster R, Joseph B, Cald-

well CC, Lentsch AB, Goodman MD,

Pritts TA. Storage with ethanol attenua-

tes the red blood cell storage lesion. Sur-

gery 2022;172(6):1829-1836. https://doi.

org/10.1016/j.surg.2022.07.016.

2. D’Alessandro A, Kriebardis AG, Rinalduc-

ci S, Antonelou MH, Hansen KC, Papassi-

deri IS, Zolla L. An update on red blood

cell storage lesions, as gleaned through

biochemistry and omics technologies.

Transfusion 2015;55(1):205-219. https://

doi.org/10.1111/trf.12804.

3. Riley BC, Stansbury LG, Hasan RA, Hess

JR. Transfusion of red blood cells ≥35 days

old: A narrative review of clinical outco-

mes. Transfusion 2023;63(11):2179-2187.

https://doi.org/10.1111/trf.17536.

4. Zuckerman J, Coburn N, Callum J, Ma-

har AL, Acuña SA, Guttman MP, et al.

Association of perioperative red blood cell

transfusions with all-cause and cancer-spe-

cific death in patients undergoing surgery

for gastrointestinal cancer: Long-term

outcomes from a population-based cohort.

Surgery 2021;170(3):870-879. https://

doi.org/10.1016/j.surg.2021.02.003.

5. Mangalmurti NS, Xiong Z, Hulver M, Ran-

ganathan M, Liu XH, Oriss T,et al. Loss

of red cell chemokine scavenging promo-

tes transfusion-related lung inflammation.

Blood 2009;113(5):1158-1166. https://

doi.org/10.1182/blood-2008-07-166264.

6. Straat M, Böing AN, Tuip-De Boer A,

Nieuwland R, Juffermans NP. Extracellu-

lar Vesicles from Red Blood Cell Products

Induce a Strong Proinflammatory Host

Response, Dependent on Both Numbers

and Storage Duration. Transfus Med He-

mother 2016;43(4):302-305. https://doi.

org/10.1159/000442681.

7. Nogueira D, Rocha S, Abreu E, Costa E,

Santos-Silva A. Biochemical and cellular

changes in leukocyte-depleted red blood

cells stored for transfusion. Transfus Med

Hemother 2015;42(1):46-51. https://doi.

org/10.1159/000370140.

8. Wang F, Ling L, Yu D. MicroRNAs in

β-thalassemia. Am J Med Sci 2021;362(1):5-

12. https://doi.org/10.1016/j.amjms.2021.

02.011.

9. Kannan M, Atreya C. Differential profi-

ling of human red blood cells during sto-

rage for 52 selected microRNAs. Transfu-

sion 2010;50(7):1581-1588. https://doi.

org/10.1111/j.1537-2995.2010.02585.x.

10. Guo JU, Agarwal V, Guo H, Bartel DP. Ex-

panded identification and characterization

of mammalian circular RNAs. Genome Biol

2014;15(7):409. https://doi.org/10.1186/

s13059-014-0409-z.

11. Listowski MA, Heger E, Bogusławska

DM, Machnicka B, Kuliczkowski K, Le-

luk J, Sikorski AF. microRNAs: fine tu-

ning of erythropoiesis. Cell Mol Biol Lett

2013;18(1):34-46. https://doi.org/10.247

8/s11658-012-0038-z.

12. Fang X, Shen F, Lechauve C, Xu P, Zhao

G, Itkow J, et al. miR-144/451 represses

the LKB1/AMPK/mTOR pathway to pro-

mote red cell precursor survival during

recovery from acute anemia. Haematologi-

ca 2018;103(3):406-416. https://doi.org/

10.3324/haematol.2017.177394.

13. Huang H, Zhu J, Fan L, Lin Q, Fu D, Wei

B, Wei S. MicroRNA Profiling of Exosomes

Derived from Red Blood Cell Units: Impli-

cations in Transfusion-Related Immunomo-

dulation. Biomed Res Int 2019. https://doi.

org/10.1155/2019/2045915.

14. Zhao K, Wang L, Li T, Zhu M, Zhang

C, Chen L, et al. The role of miR-451

in the switching between proliferation

and migration in malignant glioma cells:

AMPK signaling, mTOR modulation and

Rac1 activation required. Int J Oncol

2017;50(6):1989-1899. https://doi.org/1

0.3892/ijo.2017.3973.

298 Wang et al.

Investigación Clínica 66(3): 2025

15. Peng Z, Luo R, Xie T, Zhang W, Liu H,

Wang W, et al. Erythrocyte Adenosine A2B

Receptor-Mediated AMPK Activation: A

Missing Component Counteracting CKD

by Promoting Oxygen Delivery. J Am Soc

Nephrol 2019;30(8):1413-1424. https://

doi.org/10.1681/ASN.2018080862.

16. Longo V, Marrocco C, Zolla L, Rinal-

ducci S. Label-free quantitation of phos-

phopeptide changes in erythrocyte mem-

branes: towards molecular mechanisms

underlying deformability alterations in

stored red blood cells. Haematologica

2014;99(7):e122-125. https://doi.org/10.

3324/haematol.2013.103333.

17. Simcox J, Lamming DW. The cen-

tral moTOR of metabolism. Dev Cell

2022;57(6):691-706. https://doi.org/10.1

016/j.devcel.2022.02.024.

18. D’Alessandro A, Xia Y. Erythrocyte adapti-

ve metabolic reprogramming under physio-

logical and pathological hypoxia. Curr Opin

Hematol 2020;27(3):155-162. https://doi.

org/10.1097/MOH.0000000000000574.

19. Karafin MS, Francis RO. Impact of G6PD

status on red cell storage and transfusion

outcomes. Blood Transfus 2019;17(4):289-

295. https://doi.org/10.2450/2019.0092-19.

20. Silic-Benussi M, Sharova E, Ciccare-

se F, Cavallari I, Raimondi V, Urso L,

et al. mTOR inhibition downregulates

glucose-6-phosphate dehydrogenase and

induces ROS-dependent death in T-cell

acute lymphoblastic leukemia cells. Re-

dox Biol 2022;51:102268. https://doi.

org/10.1016/j.redo x.2022.102268.

21. Nemkov T, Stefanoni D, Bordbar A, Is-

saian A, Palsson BO, Dumont LJ, et al.

Blood donor exposome and impact of com-

mon drugs on red blood cell metabolism.

JCI Insight 2021;6(3): e146175. https://

doi.org/10.1172/jci.insight.146175.

22. Zhang Y, Xiang J, Sheng X, Zhu N, Deng S,

Chen J,et al. GM-CSF enhanced the effect

of CHOP and R-CHOP on inhibiting diffu-

se large B-cell lymphoma progression via

influencing the macrophage polarization.

Cancer Cell Int 2021;21(1):141. https://

doi.org/10.1186/s12935-021-01838-7.

23. Deswal B, Bagchi U, Santra MK, Garg M, Ka-

poor S. Inhibition of STAT3 by 2-Methoxyes-

tradiol suppresses M2 polarization and pro-

tumoral functions of macrophages in breast

cancer. BMC Cancer 2024;24(1):1129.

https://doi.org/10.1186/s12885-024-

12871-w.

24. Li ZZ, Wang XX, Ma L, Wang H, Xu JM, Zhou

XF, et al. Influence of different erythrocyte

storage times on the macrophage response

in haemorrhagic shock mice. J Int Med Res

2020;48(8):300060520947872. https://

doi.org/10.1177/0300060520947872.

25. Roussel C, Morel A, Dussiot M, Marin

M, Colard M, Fricot-Monsinjon A, et al.

Rapid clearance of storage-induced mi-

croerythrocytes alters transfusion recovery.

Blood 2021;137(17):2285-2298. https://

doi.org/10.1182/blood.2020008563.

26. Sut C, Tariket S, Chou ML, Garraud O,

Laradi S, Hamzeh-Cognasse H, et al.

Duration of red blood cell storage and

inflammatory marker generation. Blood

Transfus 2017;15(2):145-152. https://doi.

org/10.2450/2017.0343-16.

27. Obrador R, Musulin S, Hansen B. Red

blood cell storage lesion. J Vet Emerg Crit

Care (San Antonio) 2015;25(2):187-199.

https://doi.org/10.1111/vec.12252.

28. Chen X, Xie X, Xing Y, Yang X, Yuan Z,

Wei Y. MicroRNA Dysregulation Associated

with Red Blood Cell Storage. Transfus Med

Hemother 2018;45(6):397-402. https://

doi.org/10.1159/000489321.

29. Sarachana T, Kulkarni S, Atreya CD. Eva-

luation of small noncoding RNAs in ex

vivo stored human mature red blood cells:

changes in noncoding RNA levels corre-

late with storage lesion events. Transfu-

sion 2015;55(11):2672-2683. https://doi.

org/10.1111/trf.13235.

30. Mitchell A, Gray W, Rooney K, Mohamed

I, Quyyumi A, Roback J, Searles C. Abs-

tract 443: Red Blood Cell Microparticles

Mediate Transfer of Functional miR-451 to

Endothelial Cells in vitro. Arteriosclerosis,

Thrombosis, and Vascular Biology. 2015;

35(Suppl_1). https://doi.org/10.1161/atv

b.35.suppl_1.443

miR-451 improves red blood cell storage lesions 299

Vol. 66(3): 282 - 300, 2025

31. Zhang J, Zhang D, Zhao J, Zheng W. MiR-

33a-5p in stored red blood cells regulates

genes of innate immune response and pro-

motes inflammation. Aging (Albany NY)

2024;16(12):10239-10251. https://doi.

org/10.18632/aging.205925.

32. McFaul SJ, Corley JB, Mester CW, Nath J.

Packed blood cells stored in AS-5 become

proinflammatory during storage. Transfu-

sion 2009;49(7):1451-1460. https://doi.

org/10.1111/j.1537-2995.2009.02158.x.

33. Lennon CS, Cao H, Hall AM, Vickers MA,

Barker RN. The red blood cell as a novel

regulator of human B-cell activation. Im-

munology 2021;163(4):436-447. https://

doi.org/10.1111/imm.13327.

34. Pradhan P, Vijayan V, Gueler F, Immens-

chuh S. Interplay of Heme with Macropha-

ges in Homeostasis and Inflammation. Int

J Mol Sci. 2020;21(3):740. https://doi.

org/10.3390/ijms21030740

35. Antonelou MH, Seghatchian J. Insights

into red blood cell storage lesion: Toward

a new appreciation. Transfus Apher Sci

2016;55(3):292-301. https://doi.org/10.

1016/j.transci.2016.10.019.

36. Wang F, Liu YH, Zhang T, Gao J, Xu Y,

Xie GY, et al. Aging-associated changes

in CD47 arrangement and interaction

with thrombospondin-1 on red blood cells

visualized by super-resolution imaging.

Aging Cell 2020;19(10):e13224. https://

doi.org/10.1111/acel.13224.

37. Locati M, Curtale G, Mantovani A. Di-

versity, Mechanisms, and Significan-

ce of Macrophage Plasticity. Annu Rev

Pathol 2020;15:123-147. https://doi.org/

10.1146/annurev-pathmechdis-012418-

012718.

38. An Y, Yang Q. MiR-21 modulates the pola-

rization of macrophages and increases the

effects of M2 macrophages on promoting

the chemoresistance of ovarian cancer.

Life Sci 2020;242:117162. https://doi.

org/10.1016/j.lfs.2019.117162.

39. Liu Q, Yang C, Wang S, Shi D, Wei C,

Song J, et al. Wnt5a-induced M2 polariza-

tion of tumor-associated macrophages via

IL-10 promotes colorectal cancer progres-

sion. Cell Commun Signal 2020;18(1):51.

https://doi.org/10.1186/s12964-020-

00557-2.

40. Chen L, Gao B, Zhang Y, Lu H, Li X,

Pan L, et al. PAR2 promotes M1 ma-

crophage polarization and inflammation

via FOXO1 pathway. J Cell Biochem

2019;120(6):9799-9809. https://doi.org/1

0.1002/jcb.28260.

41. Salvagno GL, Sanchis-Gomar F, Picanza

A, Lippi G. Red blood cell distribution

width: A simple parameter with multiple

clinical applications. Crit Rev Clin Lab Sci

2015;52(2):86-105. https://doi.org/10.31

09/10408363.2014.992064.

42. Baig MS, Liu D, Muthu K, Roy A, Saqib U,

Naim A, et al.Heterotrimeric complex of p38

MAPK, PKCδ, and TIRAP is required for AP1

mediated inflammatory response. Int Immu-

nopharmacol 2017;48:211-218. https://doi.

org/10.1016/j.intimp.2017. 04.028.

43. Sánchez-Vera I, Saura-Esteller J, Núñez-

Vázquez S, Cosialls AM, Ghashghaei O,

Lavilla R, et al. The prohibitin-binding

compound fluorizoline induces the proin-

flammatory cytokines interleukin-8 and in-

terleukin-6 through the activation of JNK

and p38 MAP kinases. Biochem Pharma-

col 2023;218:115860. https://doi.org/10.

1016/j.bcp.2023.115860.

44. Zhang L, Park JY, Zhao D, Kwon HC,

Yang HO. Neuroprotective Effect of As-

tersaponin I against Parkinson’s Disease

through Autophagy Induction. Biomol

Ther (Seoul) 2021;29(6):615-629. https://

doi.org/10.4062/biomolther.2021.004.

45. Xiong XQ, Geng Z, Zhou B, Zhang F,

Han Y, Zhou YB, et al. FNDC5 attenuates

adipose tissue inflammation and insulin

resistance via AMPK-mediated macropha-

ge polarization in obesity. Metabolism

2018;83:31-41. https://doi.org/10.1016/j.

metabol.2018.01.013.

46. Xu X, Gao W, Li L, Hao J, Yang B, Wang

T, et al.Annexin A1 protects against cere-

bral ischemia-reperfusion injury by modu-

lating microglia/macrophage polarization

via FPR2/ALX-dependent AMPK-mTOR

pathway. J Neuroinflammation 2021;18

(1):119. https://doi.org/10.1186/s12974-

021-02174-3

300 Wang et al.

Investigación Clínica 66(3): 2025

47. Suto T, Karonitsch T. The immunobio-

logy of mTOR in autoimmunity. J Au-

toimmun 2020;110:102373. https://doi.

org/10.1016/j.jaut.2019.102373.

48. Festuccia WT. Regulation of Adipocyte and

Macrophage Functions by mTORC1 and 2

in Metabolic Diseases. Mol Nutr Food Res

2021;65(1):e1900768. https://doi.org/10.

1002/mnfr.201900768.

49. Chen X, Tang J, Shuai W, Meng J, Feng

J, Han Z. Macrophage polarization and

its role in the pathogenesis of acute lung

injury/acute respiratory distress syndro-

me. Inflamm Res 2020;69(9):883-895.

https://doi.org/10.1007/s00011-020-

01378-2.

50. Xie R, Yang Y, Zhu Y, Gao L, Jiang X,

Sun J, et al. Microparticles in red cell

concentrates prime polymorphonuclear

neutrophils and cause acute lung injury

in a two-event mouse model. Int Immu-

nopharmacol 2018;55:98-104. https://doi.

org/10.1016/j.intimp.2017.11.029.

51. Yoshida T, Prudent M, D’Alessandro A.

Red blood cell storage lesion: causes and

potential clinical consequences. Blood

Transfus 2019;17(1):27-52. https://doi.org

/10.2450/2019.0217-18.

52. Zimring JC. Established and theoretical

factors to consider in assessing the red cell

storage lesion. Blood 2015;125(14):2185-

2190. https://doi.org/10.1182/blood-2014

-11-567750.